Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-22-3p URS0000096022_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-22: hsa-mir-22 is a highly expressed miRNA in the heart that regulates the expression and function of genes involved in various cardiac processes such as hypertrophy, sarcomere recombination, and metabolic program changes. It also plays a regulatory role in oxidative stress, cardiomyocyte apoptosis, autophagy, hypertrophy, fibrosis, and regeneration [PMC8691998]. In a study using HEK293 cells, it was found that hsa-mir-22 can modulate the activity of NF-κB1-4 and p21-3′UTR luciferase reporter genes [PMC6064715]. In the context of probiotic environment analysis from TCGA and GEO databases, hsa-mir-22 was identified as one of the differentially expressed miRNAs [PMC8806860]. Furthermore, in hepatocellular carcinoma (HCC) tissues with venous metastasis compared to those without venous metastasis, hsa-mir-22 was found to be down-regulated along with several other miRNAs [PMC6287006]. These findings suggest that hsa-mir-22 may have important roles in cardiac function regulation as well as in cancer progression.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus (chicken) gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Lagothrix lagotricha lla-miR-22
  22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) mml-miR-22
  26. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-22
  29. Mus musculus mmu-miR-22-3p
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  31. Ophiophagus hannah oha-miR-22a
  32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  33. Oryctolagus cuniculus ocu-miR-22-3p
  34. Otolemur garnettii oga-miR-22
  35. Pan paniscus ppa-miR-22
  36. Pan troglodytes ptr-miR-22
  37. Papio hamadryas (hamadryas baboon) pha-miR-22
  38. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
  39. Pteropus alecto (black flying fox) pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus rno-miR-22-3p
  42. Saguinus labiatus sla-miR-22
  43. Saimiri boliviensis boliviensis sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa ssc-miR-22-3p
  47. Taeniopygia guttata Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
Publications