Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-22-3p URS0000096022_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-22: hsa-mir-22 is a highly expressed miRNA in the heart that regulates the expression and function of genes involved in various cardiac processes such as hypertrophy, sarcomere recombination, and metabolic program changes. It also plays a regulatory role in oxidative stress, cardiomyocyte apoptosis, autophagy, hypertrophy, fibrosis, and regeneration [PMC8691998]. In a study using HEK293 cells, it was found that hsa-mir-22 can modulate the activity of NF-κB1-4 and p21-3′UTR luciferase reporter genes [PMC6064715]. In the context of probiotic environment analysis from TCGA and GEO databases, hsa-mir-22 was identified as one of the differentially expressed miRNAs [PMC8806860]. Furthermore, in hepatocellular carcinoma (HCC) tissues with venous metastasis compared to those without venous metastasis, hsa-mir-22 was found to be down-regulated along with several other miRNAs [PMC6287006]. These findings suggest that hsa-mir-22 may have important roles in cardiac function regulation as well as in cancer progression.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris (dog) cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Cervus elaphus cel-miR-22-3p
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  12. Chrysemys picta cpi-miR-22-3p
  13. Columba livia cli-miR-22-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  15. Dasypus novemcinctus dno-miR-22-3p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-22
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-22
  19. Gallus gallus gga-miR-22-3p
  20. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  21. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus Loc-Mir-22-P1b_3p (mature (guide))
  25. Macaca mulatta mml-miR-22
  26. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-22
  29. Mus musculus mmu-miR-22-3p
  30. Nomascus leucogenys nle-miR-22
  31. Ophiophagus hannah (king cobra) oha-miR-22a
  32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  33. Oryctolagus cuniculus (rabbit) ocu-miR-22-3p
  34. Otolemur garnettii (small-eared galago) oga-miR-22
  35. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  36. Pan troglodytes (chimpanzee) ptr-miR-22
  37. Papio hamadryas pha-miR-22
  38. Pongo pygmaeus ppy-miR-22
  39. Pteropus alecto pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus (Norway rat) rno-miR-22-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-22-3p
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis xtr-miR-22-3p
Publications