Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-22-3p URS0000096022_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Alligator mississippiensis Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-22
  5. Bos taurus Bta-Mir-22-P1b_3p (mature (guide))
  6. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-22
  7. Callorhinchus milii Cmi-Mir-22-P1b_3p (mature (guide))
  8. Canis lupus familiaris cfa-miR-22
  9. Cavia porcellus cpo-miR-22-3p
  10. Chrysemys picta bellii Cpi-Mir-22-P1b_3p (mature (guide))
  11. Chrysemys picta cpi-miR-22-3p
  12. Columba livia cli-miR-22-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-22-3p
  15. Daubentonia madagascariensis (aye-aye) dma-miR-22
  16. Echinops telfairi Ete-Mir-22-P1b_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-22
  18. Gallus gallus (chicken) gga-miR-22-3p
  19. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  20. Homo sapiens (human) hsa-miR-22-3p
  21. Lagothrix lagotricha lla-miR-22
  22. Latimeria chalumnae Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  25. Macaca mulatta (Rhesus monkey) mml-miR-22
  26. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  27. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) mmr-miR-22
  29. Mus musculus mmu-miR-22-3p
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  31. Ophiophagus hannah oha-miR-22a
  32. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  33. Oryctolagus cuniculus ocu-miR-22-3p
  34. Otolemur garnettii oga-miR-22
  35. Pan paniscus ppa-miR-22
  36. Pan troglodytes ptr-miR-22
  37. Papio hamadryas (hamadryas baboon) pha-miR-22
  38. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
  39. Pteropus alecto (black flying fox) pal-miR-22-3p
  40. Python bivittatus pbv-miR-22-3p
  41. Rattus norvegicus rno-miR-22-3p
  42. Saguinus labiatus sla-miR-22
  43. Saimiri boliviensis boliviensis sbo-miR-22
  44. Scyliorhinus torazame Sto-Mir-22-P1b_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  46. Sus scrofa ssc-miR-22-3p
  47. Taeniopygia guttata Tgu-Mir-22-P1b_3p (mature (guide))
  48. Tupaia chinensis tch-miR-22-3p
  49. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  50. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p