Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) Bta-Mir-22-P1b_3p (mature (guide)) URS0000096022_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-22: bta-mir-22, a microRNA identified in bovine species, plays a role in various biological pathways, including the mitochondrial L-carnitine shuttle pathway and calcium signaling, with a significant impact on pathways related to proteolysis and apoptosis [PMC6182065]. It targets the glutathione reductase (GSR) gene and is involved in the actin cytoskeleton signaling pathway [PMC6182065]. This microRNA is also implicated in muscle tenderness regulation and shares targets with lethal (let-7) miRNA [PMC6182065]. It has been identified as a potential regulator of tenderness through RIF analysis and has been found to target transcripts involved in calcium transport such as CACNA1B and ATP2B2 [PMC6182065]. bta-mir-22 is associated with transcripts related to oxygen storage and transport in muscle fibers, such as myoglobin (MB), and also targets genes involved in proteolysis like calpastatin (CAST) and calpain family members CAPN1 and CAPN11 [PMC6182065]. Furthermore, bta-mir-22 has been differentially expressed in bovine macrophages responding to M. bovis infection, suggesting its role in immune response regulation [PMC4978967]. Its high similarity to human miRNAs suggests potential functional relevance across species [PMC4167851], particularly during the late follicular phase of the bovine estrous cycle [PMC4438052].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGUUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-22-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-22-P1b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-22
  4. Ateles geoffroyi age-miR-22
  5. Callithrix jacchus cja-miR-22
  6. Callorhinchus milii (elephant shark) Cmi-Mir-22-P1b_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-22
  8. Cavia porcellus (domestic guinea pig) cpo-miR-22-3p
  9. Cervus elaphus (red deer) cel-miR-22-3p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-22-P1b_3p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-22-3p
  12. Columba livia cli-miR-22-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-22-3p
  14. Dasypus novemcinctus dno-miR-22-3p
  15. Daubentonia madagascariensis (aye-aye) dma-miR-22
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-22-P1b_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-22
  18. Gallus gallus gga-miR-22-3p
  19. Gekko japonicus Gja-Mir-22-P1b_3p (mature (guide))
  20. Homo sapiens hsa-miR-22-3p
  21. Lagothrix lagotricha (brown woolly monkey) lla-miR-22
  22. Latimeria chalumnae (coelacanth) Lch-Mir-22-P1b_3p (mature (guide))
  23. Lemur catta (Ring-tailed lemur) lca-miR-22
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-22-P1b_3p (mature (guide))
  25. Loxodonta africana (African savanna elephant) Laf-Mir-22-P1b_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-22
  27. Macaca nemestrina (pig-tailed macaque) mne-miR-22
  28. Microcaecilia unicolor Mun-Mir-22-P1b_3p (mature (guide))
  29. Microcebus murinus (gray mouse lemur) mmr-miR-22
  30. Mus musculus mmu-miR-22-3p
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-22
  32. Ophiophagus hannah oha-miR-22a
  33. Ornithorhynchus anatinus (platypus) oan-miR-22-3p
  34. Oryctolagus cuniculus ocu-miR-22-3p
  35. Otolemur garnettii oga-miR-22
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-22
  37. Pan troglodytes ptr-miR-22
  38. Papio hamadryas (hamadryas baboon) pha-miR-22
  39. Pongo abelii (Sumatran orangutan) Pab-Mir-22-P1b_3p (mature (guide))
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-22
  41. Pteropus alecto (black flying fox) pal-miR-22-3p
  42. Python bivittatus (Burmese python) pbv-miR-22-3p
  43. Rattus norvegicus (Norway rat) rno-miR-22-3p
  44. Saguinus labiatus (red-chested mustached tamarin) sla-miR-22
  45. Saimiri boliviensis boliviensis sbo-miR-22
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-22-P1b_3p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-22-P1b_3p (mature (guide))
  48. Sus scrofa ssc-miR-22-3p
  49. Taeniopygia guttata (zebra finch) Tgu-Mir-22-P1b_3p (mature (guide))
  50. Tupaia chinensis (Chinese tree shrew) tch-miR-22-3p
  51. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b4_3p (mature (co-guide))
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-22-3p
Relationships

Molecular Relationships