Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-200a-3p URS000008DA94_9544

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Macaca mulatta. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 5 papers. Macaca mulatta (Rhesus monkey) mml-miR-200a-3p sequence is a product of mml-miR-200a-3p, miR-200a-3p, miR-200, miR-200a, mml-miR-200a, MIR200A genes. Found in the rhesus monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAACACUGUCUGGUAACGAUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Alligator mississippiensis ami-miR-200a-3p
    2. Anolis carolinensis aca-miR-200a-3p
    3. Capra hircus miR-200a
    4. Chiloscyllium plagiosum microRNA cpl-miR-200a
    5. Danio rerio (zebrafish) dre-miR-200a-3p
    6. Equus caballus (horse) eca-miR-200a
    7. Gadus morhua gmo-miR-200a-3p
    8. Gallus gallus (chicken) gga-miR-200a-3p
    9. Gorilla gorilla (western gorilla) ggo-miR-200a
    10. Homo sapiens hsa-miR-200a-3p
    11. Monodelphis domestica mdo-miR-200a-3p
    12. Mus musculus (house mouse) mmu-miR-200a-3p
    13. Ovis aries miscellaneous RNA
    14. Pan troglodytes (chimpanzee) ptr-miR-200a
    15. Pongo pygmaeus ppy-miR-200a
    16. Rattus norvegicus rno-miR-200a-3p
    17. Takifugu rubripes (torafugu) fru-miR-200a
    18. Tetraodon nigroviridis tni-miR-200a
    19. Tor tambroides miR-200a-3p
    20. Xenopus tropicalis xtr-miR-200a