Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-146a-5p URS000050B527_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 3 databases (miRBase, ENA, RefSeq). Gallus gallus (chicken) gga-miR-146a-5p sequence is a product of gga-miR-146a, miR-146a, miR-146a-5p, gga-miR-146a-5p, MIR146A, miR-146 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGAACUGAAUUCCAUGGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Alligator mississippiensis Ami-Mir-146-P4_5p (mature (guide))
    2. Callithrix jacchus cja-miR-146a
    3. Canis lupus familiaris cfa-miR-146a
    4. Cervus elaphus (red deer) cel-miR-146a
    5. Cricetulus griseus (Chinese hamster) cgr-miR-146a
    6. Equus caballus (horse) eca-miR-146a
    7. Homo sapiens (human) hsa-miR-146a-5p
    8. Macaca mulatta mml-miR-146a-5p
    9. Microcebus murinus mmr-miR-146a
    10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-146a-5p
    11. Mus musculus mmu-miR-146a-5p
    12. Nomascus leucogenys nle-miR-146a
    13. Pan troglodytes ptr-miR-146a
    14. Papio hamadryas pha-miR-146a
    15. Pongo pygmaeus ppy-miR-146a
    16. Pteropus alecto (black flying fox) pal-miR-146a-5p
    17. Rattus norvegicus (Norway rat) rno-miR-146a-5p
    18. Sus scrofa (pig) ssc-miR-146a-5p
    19. Taeniopygia guttata tgu-miR-146c
    20. Tupaia chinensis (Chinese tree shrew) tch-miR-146a-5p
    Publications New