Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-486 URS00004BF1DC_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-486: Rno-mir-486 is a microRNA that has been studied in various contexts. In a study comparing different groups, the expression levels of rno-mir-486 were found to be significantly higher in a polycystic ovary syndrome (PCOS) model [PMC5637260]. Another study using sRNA-seq found that rno-mir-486 was downregulated in injured samples compared to normal samples [PMC9141346]. In the context of spinal cord injury (SCI) recovery, rno-mir-486 was identified as one of the candidate miRNAs involved [PMC7339738]. However, there was no significant difference in the expression levels of rno-mir-486 between different groups in another study on SCI recovery [PMC7339738]. Rno-mir-486 was also found to be one of the most abundant mature miRNAs identified in a study on exercise-induced changes in miRNA expression [PMC5976735]. Additionally, rno-mir-486 has been associated with various diseases such as colorectal disease and prostate and pancreatic cancers [PMC6203938]. Furthermore, it has been shown that rno-mir-486 targets specific genes involved in certain pathways related to disease progression and recovery [PMC7339738] [PMC7023842] [PMC6203938]. Overall, these studies highlight the importance of rno-mir-486 as a potential biomarker and therapeutic target in various pathological conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGUACUGAGCUGCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-486
  2. Canis lupus familiaris Cfa-Mir-486_5p (mature (guide))
  3. Cavia porcellus cpo-miR-486-5p
  4. Cricetulus griseus cgr-miR-486-5p
  5. Dasypus novemcinctus dno-miR-486-5p
  6. Echinops telfairi Ete-Mir-486_5p (mature (guide))
  7. Equus caballus eca-miR-486-5p
  8. Gorilla gorilla gorilla ggo-miR-486 (MIR486)
  9. Gorilla gorilla (western gorilla) ggo-miR-486
  10. Homo sapiens hsa-miR-486-5p
  11. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-486
  12. Macaca fascicularis microRNA miR-486-5p
  13. Macaca mulatta (Rhesus monkey) mml-miR-486-5p
  14. Mus musculus (house mouse) mmu-miR-486b-5p
  15. Pan troglodytes ptr-miR-486
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-486-5p
  17. Pteropus alecto pal-miR-486a-5p
  18. Sus scrofa ssc-miR-486
Publications