Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-486 URS00004BF1DC_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGUACUGAGCUGCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-486
  2. Canis lupus familiaris Cfa-Mir-486_5p (mature (guide))
  3. Cavia porcellus cpo-miR-486-5p
  4. Cricetulus griseus cgr-miR-486-5p
  5. Dasypus novemcinctus dno-miR-486-5p
  6. Echinops telfairi Ete-Mir-486_5p (mature (guide))
  7. Equus caballus eca-miR-486-5p
  8. Gorilla gorilla gorilla ggo-miR-486 (MIR486)
  9. Homo sapiens hsa-miR-486-5p
  10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-486
  11. Macaca fascicularis microRNA miR-486-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-486-5p
  13. Mus musculus (house mouse) mmu-miR-486b-5p
  14. Pan troglodytes ptr-miR-486
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-486-5p
  16. Pteropus alecto pal-miR-486a-5p
  17. Rattus norvegicus rno-miR-486
  18. Sus scrofa ssc-miR-486
Publications