Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-486 URS00004BF1DC_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-486: Bta-mir-486 is a microRNA that has been found to be associated with skeletal muscle growth and downregulated in feed efficient animals [PMC6637853]. Functional enrichment analysis of bta-mir-486 and other microRNAs indicated that the insulin signaling pathway was over-represented in both tissues [PMC6244318]. In a reference Nelore population, bta-miR-423-5p and bta-mir-486 were differentially expressed between extreme groups for IMF31 and RFI66, respectively [PMC8016890]. Bta-mir-486 was identified as a top regulator for CLA content [PMC6637853]. In the development stages, bta-mir-486 was one of the top 20 most abundant microRNAs [PMC7073773]. Additionally, it was found that bta-miR-2285p, bta-miR-98, bta-miR-155, bta-miR-374b, and bta-mir-486 target transcripts involved in signaling pathways regulating pluripotency of stem cells, mTOR signaling, and FoxO signaling [PMC9581129]. In summary, bta-mir-486 is a microRNA associated with skeletal muscle growth and downregulated in feed efficient animals. It is involved in the insulin signaling pathway and has been identified as a top regulator for CLA content. Bta-miR-423-5p and bta-mir-486 are differentially expressed between extreme groups for IMF31 and RFI66. Bta-mir 486 is one of the most abundant microRNAs during development stages. It targets transcripts involved in pluripotency of stem cells, mTOR signaling, and FoxO signaling pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGUACUGAGCUGCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Canis lupus familiaris Cfa-Mir-486_5p (mature (guide))
  2. Cavia porcellus cpo-miR-486-5p
  3. Cricetulus griseus cgr-miR-486-5p
  4. Dasypus novemcinctus dno-miR-486-5p
  5. Echinops telfairi Ete-Mir-486_5p (mature (guide))
  6. Equus caballus eca-miR-486-5p
  7. Gorilla gorilla gorilla ggo-miR-486 (MIR486)
  8. Gorilla gorilla (western gorilla) ggo-miR-486
  9. Homo sapiens hsa-miR-486-5p
  10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-486
  11. Macaca fascicularis microRNA miR-486-5p
  12. Macaca mulatta (Rhesus monkey) mml-miR-486-5p
  13. Mus musculus (house mouse) mmu-miR-486b-5p
  14. Pan troglodytes ptr-miR-486
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-486-5p
  16. Pteropus alecto pal-miR-486a-5p
  17. Rattus norvegicus rno-miR-486
  18. Sus scrofa ssc-miR-486
Publications