Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-486 URS00004BF1DC_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-486: Ssc-mir-486 is a microRNA that has been found to play a role in various biological processes in pigs. It has been implicated in the differentiation of preadipocytes and adipogenesis [PMC9603960]. Additionally, ssc-mir-486 has been shown to be significantly upregulated in the TK group during isolated kidney perfusion, suggesting its potential importance in this process [PMC9275911]. Ssc-mir-486 has also been identified as a target of certain transcription factors that regulate adipose-related biological processes [PMC9859024]. Furthermore, ssc-mir-486 has been found to bind to the 3' UTR of CHsx1401, along with other differentially expressed microRNAs [PMC10000162]. Inhibition of T cell differentiation by ssc-mir-486 and other microRNAs has also been observed [PMC6354428]. The expression pattern of ssc-mir-486, along with other differentially expressed microRNAs, was validated using sRNA sequencing data [PMC5815207]. Overall, these findings suggest that ssc-mir-486 may have important regulatory roles in various biological processes and may serve as a potential target for further investigation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGUACUGAGCUGCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-486
  2. Canis lupus familiaris Cfa-Mir-486_5p (mature (guide))
  3. Cavia porcellus cpo-miR-486-5p
  4. Cricetulus griseus cgr-miR-486-5p
  5. Dasypus novemcinctus dno-miR-486-5p
  6. Echinops telfairi Ete-Mir-486_5p (mature (guide))
  7. Equus caballus eca-miR-486-5p
  8. Gorilla gorilla gorilla ggo-miR-486 (MIR486)
  9. Gorilla gorilla (western gorilla) ggo-miR-486
  10. Homo sapiens hsa-miR-486-5p
  11. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-486
  12. Macaca fascicularis microRNA miR-486-5p
  13. Macaca mulatta (Rhesus monkey) mml-miR-486-5p
  14. Mus musculus (house mouse) mmu-miR-486b-5p
  15. Pan troglodytes ptr-miR-486
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-486-5p
  17. Pteropus alecto pal-miR-486a-5p
  18. Rattus norvegicus rno-miR-486
Publications