Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-205-5p URS0000446722_9986

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ocu-mir-205: ocu-mir-205 is a microRNA that plays a crucial role in regulating hair follicle development and hair density in Rex rabbits [PMC7178635]. It suppresses the expression of Notch signaling pathway genes, including Notch1, Jagged1, Hes1, and Hes5 [PMC7178635]. It induces the expression of BMP signaling pathway genes such as BMP2, BMP4, and TGF-β1 [PMC7178635]. ocu-mir-205 induces G0/G1 arrest in dermal papilla cells (DPCs) and increases apoptosis rates [PMC7178635]. It alters the levels of phosphorylated CTNNB1, GSK-3β, Akt proteins, and NOG protein [PMC7178635]. Furthermore, ocu-mir-205 affects cell proliferation and cell cycle progression [PMC7178635]. It is highly expressed in DPCs compared to other microRNAs analyzed [PMC7178635]. ocu-mir-205 also inhibits the expression of genes involved in the PI3K/Akt signaling pathway such as Inppl1, Frk, and Phlda3 mRNAs [PMC7178635]. Additionally, it inhibits gene expression in Wnt signaling pathway components including Wnt10b CTNNB1 and GSK-3β genes while inducing DKK1 mRNA expression [PMC7178635]. In Rex rabbits with different hair densities, ocu-mir-205 expression differs significantly between dermal papilla cells (DPCs) from rabbits with high versus low hair density [PMC7178635]. This suggests that it plays a role in determining hair density. Furthermore, ocu-mir-205 alters the expression of genes involved in the PI3K/Akt, Wnt, Notch, and BMP signaling pathways [PMC7178635]. Overall, ocu-mir-205 promotes apoptosis in DPCs and modulates the expression of genes and proteins involved in various signaling pathways to regulate hair follicle development and hair density [PMC7178635].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-205a-5p
  2. Anolis carolinensis aca-miR-205a
  3. Ateles geoffroyi age-miR-205
  4. Bos taurus bta-miR-205
  5. Callorhinchus milii (elephant shark) Cmi-Mir-205-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-205
  7. Capra hircus (goat) miR-205
  8. Cavia porcellus Cpo-Mir-205-P4_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-205
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-205-P4_5p (mature (guide))
  11. Chrysemys picta cpi-miR-205a-5p
  12. Columba livia cli-miR-205a-5p
  13. Cyprinus carpio (common carp) ccr-miR-205
  14. Danio rerio (zebrafish) dre-miR-205-5p
  15. Dasypus novemcinctus Dno-Mir-205-P4_5p (mature (guide))
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-205-P4_5p (mature (guide))
  17. Equus caballus eca-miR-205
  18. Gallus gallus (chicken) gga-miR-205a
  19. Gekko japonicus Gja-Mir-205-P4_5p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-205 (MIR205)
  21. Gorilla gorilla ggo-miR-205
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-205
  23. Homo sapiens (human) hsa-miR-205-5p
  24. Lagothrix lagotricha lla-miR-205
  25. Latimeria chalumnae (coelacanth) Lch-Mir-205-P4_5p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-205-P4_5p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-205
  28. Macaca nemestrina mne-miR-205
  29. Maylandia zebra mze-miR-205
  30. Microcaecilia unicolor Mun-Mir-205-P4_5p (mature (guide))
  31. Monodelphis domestica mdo-miR-205a
  32. Mus musculus (house mouse) mmu-miR-205-5p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-205
  34. Oreochromis niloticus oni-miR-205
  35. Ovis aries miscellaneous RNA
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-205
  37. Pan troglodytes (chimpanzee) ptr-miR-205
  38. Pongo pygmaeus ppy-miR-205
  39. Pundamilia nyererei pny-miR-205
  40. Python bivittatus (Burmese python) pbv-miR-205a-5p
  41. Rattus norvegicus Rno-Mir-205-P4_5p (mature (guide))
  42. Salmo salar ssa-miR-205b-5p
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P4_5p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-205-P4_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-205-P4_5p (mature (guide))
  46. Sus scrofa ssc-miR-205
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P4_5p (mature (guide))
  48. Takifugu rubripes (torafugu) fru-miR-205
  49. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-205
  50. Tor tambroides (Thai mahseer) miR-205-5p
  51. Xenopus laevis (African clawed frog) xla-miR-205
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-205a
Publications