Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-205 URS0000446722_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-205: The study conducted qPCR to validate the expression levels of four randomly selected DE-miRNAs, including cfa-miR-30a, cfa-miR-124, cfa-mir-205, and cfa-miR-222 [PMC4768678]. It was found that MMD was upregulated while cfa-mir-205 was downregulated in the CFDP1_vs_CFDP2 condition [PMC4768678]. The study suggested that cfa-mir-205 might play a crucial role in upregulating MMD and enhancing the immune response in the pituitary and hippocampus under chronic stress exposure [PMC4768678]. The analysis of mRNA-seq and miRNA-seq studies identified a potential role for cfa-mir-205 in regulating MMD in the pituitary under chronic stress exposure [PMC4768678]. The dual luciferase reporter assay further confirmed a significant target relationship between cfa-mir-205 and MMD [PMC4768678]. qPCR analysis of brain tissues showed that both MMD and cfa-mir-205 expression levels were examined in the CFD brain, cerebellum, hippocampus, and hypothalamus tissues [PMC4768678]. The study suggested that cfa-mir-205 might play an important role in regulating MMD under chronic stress exposure based on its expression levels [PMC4768678]. It was hypothesized that MMD would be upregulated while cfa-mir-205 would be downregulated in CFDP1_vs_CFDP2 based on macrophage transfer from monocytes [PMC4768678]. The results showed significant downregulation of both cfa-miR-30a and cfa-mir-205 in CFDP1_vs_CFDP2 condition [PMC4768678]. Lentiviral vectors were used to inhibit or overexpress cfa-mir-205 and inhibit NOTCH2 [PMC7860583]. The study predicted that several miRNAs, including cfa-mir-205, might regulate IgSF genes [PMC7689213].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-205a-5p
  2. Anolis carolinensis aca-miR-205a
  3. Ateles geoffroyi age-miR-205
  4. Bos taurus bta-miR-205
  5. Callorhinchus milii (elephant shark) Cmi-Mir-205-P4_5p (mature (guide))
  6. Capra hircus (goat) miR-205
  7. Cavia porcellus Cpo-Mir-205-P4_5p (mature (guide))
  8. Cervus elaphus (red deer) cel-miR-205
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-205-P4_5p (mature (guide))
  10. Chrysemys picta cpi-miR-205a-5p
  11. Columba livia cli-miR-205a-5p
  12. Cyprinus carpio (common carp) ccr-miR-205
  13. Danio rerio (zebrafish) dre-miR-205-5p
  14. Dasypus novemcinctus Dno-Mir-205-P4_5p (mature (guide))
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-205-P4_5p (mature (guide))
  16. Equus caballus eca-miR-205
  17. Gallus gallus (chicken) gga-miR-205a
  18. Gekko japonicus Gja-Mir-205-P4_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-205 (MIR205)
  20. Gorilla gorilla ggo-miR-205
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-205
  22. Homo sapiens (human) hsa-miR-205-5p
  23. Lagothrix lagotricha lla-miR-205
  24. Latimeria chalumnae (coelacanth) Lch-Mir-205-P4_5p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-205-P4_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-205
  27. Macaca nemestrina mne-miR-205
  28. Maylandia zebra mze-miR-205
  29. Microcaecilia unicolor Mun-Mir-205-P4_5p (mature (guide))
  30. Monodelphis domestica mdo-miR-205a
  31. Mus musculus (house mouse) mmu-miR-205-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-205
  33. Oreochromis niloticus oni-miR-205
  34. Oryctolagus cuniculus (rabbit) ocu-miR-205-5p
  35. Ovis aries miscellaneous RNA
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-205
  37. Pan troglodytes (chimpanzee) ptr-miR-205
  38. Pongo pygmaeus ppy-miR-205
  39. Pundamilia nyererei pny-miR-205
  40. Python bivittatus (Burmese python) pbv-miR-205a-5p
  41. Rattus norvegicus Rno-Mir-205-P4_5p (mature (guide))
  42. Salmo salar ssa-miR-205b-5p
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P4_5p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-205-P4_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-205-P4_5p (mature (guide))
  46. Sus scrofa ssc-miR-205
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P4_5p (mature (guide))
  48. Takifugu rubripes (torafugu) fru-miR-205
  49. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-205
  50. Tor tambroides (Thai mahseer) miR-205-5p
  51. Xenopus laevis (African clawed frog) xla-miR-205
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-205a
Publications