Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-205 URS0000446722_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-205: Eca-mir-205 is a microRNA that has been found to be targeted by multiple DE_circRNAs from host genes EGFR, CATSPERD, ATP2B1, PIWIL2 [PMC9858477]. Another microRNA, Eca-miR-324-5P, is targeted by circRNAs from genes CATSPERB, SPEF2, CAMK2D, and PIWIL2 [PMC9858477]. In a study investigating the expression profile of various microRNAs in mares with endometritis, it was found that eca-miR-100 and eca-mir-205 were differentially expressed and interacted with DECs [PMC9858477]. In the same study, it was observed that eca-miR-155, eca-miR-223, eca-miR-17, eca-miR-200a and eca-mir-205 were overexpressed in both young and old diseased mares compared to control healthy mares [PMC8227551]. Furthermore,e old diseased mares showed higher expression levels of these microRNAs compared to young diseased mares [PMC8227551]. The relative abundance of these microRNAs was also higher in both young and old diseased mares compared to control healthy mares [PMC8227551]. Additionally,e these microRNAs were found to target inflammatory immune response genes such as TRAF6,TNFα , IL6 , IL8 ,and IL10 [PMC8227551]. The study aimed to investigate the expression profile of these microRNAs as well as measure the concentrations of IL6 , PGF2α ,and PGE2 in serum samples from young and old aged mares with healthy and abnormal uterine status (endometritis) [PMC8227551].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-205a-5p
  2. Anolis carolinensis aca-miR-205a
  3. Ateles geoffroyi age-miR-205
  4. Bos taurus bta-miR-205
  5. Callorhinchus milii (elephant shark) Cmi-Mir-205-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-205
  7. Capra hircus (goat) miR-205
  8. Cavia porcellus Cpo-Mir-205-P4_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-205
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-205-P4_5p (mature (guide))
  11. Chrysemys picta cpi-miR-205a-5p
  12. Columba livia cli-miR-205a-5p
  13. Cyprinus carpio (common carp) ccr-miR-205
  14. Danio rerio (zebrafish) dre-miR-205-5p
  15. Dasypus novemcinctus Dno-Mir-205-P4_5p (mature (guide))
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-205-P4_5p (mature (guide))
  17. Gallus gallus (chicken) gga-miR-205a
  18. Gekko japonicus Gja-Mir-205-P4_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-205 (MIR205)
  20. Gorilla gorilla ggo-miR-205
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-205
  22. Homo sapiens (human) hsa-miR-205-5p
  23. Lagothrix lagotricha lla-miR-205
  24. Latimeria chalumnae (coelacanth) Lch-Mir-205-P4_5p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-205-P4_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-205
  27. Macaca nemestrina mne-miR-205
  28. Maylandia zebra mze-miR-205
  29. Microcaecilia unicolor Mun-Mir-205-P4_5p (mature (guide))
  30. Monodelphis domestica mdo-miR-205a
  31. Mus musculus (house mouse) mmu-miR-205-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-205
  33. Oreochromis niloticus oni-miR-205
  34. Oryctolagus cuniculus (rabbit) ocu-miR-205-5p
  35. Ovis aries miscellaneous RNA
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-205
  37. Pan troglodytes (chimpanzee) ptr-miR-205
  38. Pongo pygmaeus ppy-miR-205
  39. Pundamilia nyererei pny-miR-205
  40. Python bivittatus (Burmese python) pbv-miR-205a-5p
  41. Rattus norvegicus Rno-Mir-205-P4_5p (mature (guide))
  42. Salmo salar ssa-miR-205b-5p
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P4_5p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-205-P4_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-205-P4_5p (mature (guide))
  46. Sus scrofa ssc-miR-205
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P4_5p (mature (guide))
  48. Takifugu rubripes (torafugu) fru-miR-205
  49. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-205
  50. Tor tambroides (Thai mahseer) miR-205-5p
  51. Xenopus laevis (African clawed frog) xla-miR-205
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-205a
Publications