Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-205 URS0000446722_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-205: Ssc-mir-205 is a microRNA that has been found to be upregulated in response to deoxynivalenol (DON) exposure in pigs [PMC8585098]. It is one of several microRNAs that showed increased abundance compared to previous time points, indicating a stronger effect of DON with longer periods of contaminated feed intake [PMC8585098]. Ssc-mir-205 was consistently upregulated in the jejunum of stressed pigs, suggesting its involvement in DON-induced effects [PMC8585098]. The upregulation of ssc-mir-205, along with ssc-miR-16, ssc-miR-128, and ssc-miR-451, was effective in distinguishing between DON-exposed and non-exposed pigs and could serve as candidate biomarkers for assessing the effects of DON [PMC8585098]. In vitro experiments showed that miR-205-5p (which has the same sequence as ssc-mir-205) suppressed the phosphorylation of p38 protein kinase and deactivated the MAPK and Wnt/β-catenin pathways, providing evidence for its involvement in DON-induced pathway suppression [PMC8585098]. Ssc-mir-205 has also been found to be upregulated in pig serum upon weaning stress and confirmed to be significantly upregulated upon DON treatment [PMC8585098]. The length of ssc-mir-205 varied from 18 to 23 nucleotides [PMC3901342]. Target prediction analysis revealed successful target gene prediction for 109 mRNAs associated with differentially expressed miRNAs including ssc-mir-205 [PMC9961432]. The mature miR-205 sequences were found to be highly conserved among pig, mouse, and human species [PMC7300349].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-205a-5p
  2. Anolis carolinensis aca-miR-205a
  3. Ateles geoffroyi age-miR-205
  4. Bos taurus bta-miR-205
  5. Callorhinchus milii (elephant shark) Cmi-Mir-205-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-205
  7. Capra hircus (goat) miR-205
  8. Cavia porcellus Cpo-Mir-205-P4_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-205
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-205-P4_5p (mature (guide))
  11. Chrysemys picta cpi-miR-205a-5p
  12. Columba livia cli-miR-205a-5p
  13. Cyprinus carpio (common carp) ccr-miR-205
  14. Danio rerio (zebrafish) dre-miR-205-5p
  15. Dasypus novemcinctus Dno-Mir-205-P4_5p (mature (guide))
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-205-P4_5p (mature (guide))
  17. Equus caballus eca-miR-205
  18. Gallus gallus (chicken) gga-miR-205a
  19. Gekko japonicus Gja-Mir-205-P4_5p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-205 (MIR205)
  21. Gorilla gorilla ggo-miR-205
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-205
  23. Homo sapiens (human) hsa-miR-205-5p
  24. Lagothrix lagotricha lla-miR-205
  25. Latimeria chalumnae (coelacanth) Lch-Mir-205-P4_5p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-205-P4_5p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-205
  28. Macaca nemestrina mne-miR-205
  29. Maylandia zebra mze-miR-205
  30. Microcaecilia unicolor Mun-Mir-205-P4_5p (mature (guide))
  31. Monodelphis domestica mdo-miR-205a
  32. Mus musculus (house mouse) mmu-miR-205-5p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-205
  34. Oreochromis niloticus oni-miR-205
  35. Oryctolagus cuniculus (rabbit) ocu-miR-205-5p
  36. Ovis aries miscellaneous RNA
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-205
  38. Pan troglodytes (chimpanzee) ptr-miR-205
  39. Pongo pygmaeus ppy-miR-205
  40. Pundamilia nyererei pny-miR-205
  41. Python bivittatus (Burmese python) pbv-miR-205a-5p
  42. Rattus norvegicus Rno-Mir-205-P4_5p (mature (guide))
  43. Salmo salar ssa-miR-205b-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P4_5p (mature (guide))
  45. Scyliorhinus torazame Sto-Mir-205-P4_5p (mature (guide))
  46. Sphenodon punctatus Spt-Mir-205-P4_5p (mature (guide))
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P4_5p (mature (guide))
  48. Takifugu rubripes (torafugu) fru-miR-205
  49. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-205
  50. Tor tambroides (Thai mahseer) miR-205-5p
  51. Xenopus laevis (African clawed frog) xla-miR-205
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-205a
Publications