Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-205-5p URS0000446722_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-205: hsa-mir-205, a specific type of microRNA, has already been proposed as a circulating biomarker of the response of the BC luminal A subtype to neoadjuvant chemotherapy [PMC5123339]. In a study, ARHGEF26-AS1 was found to interact with 7 differentially expressed microRNAs (hsa-miR-135b, hsa-miR-141, hsa-miR-187, hsa-miR-200a, hsa-mir-205, hsa-miR-27a, and hsa-miR-92b) and was coregulated with 30 differentially expressed messenger RNAs [PMC6899321]. These findings suggest that ARHGEF26-AS1 may play a role in the regulation of these microRNAs and messenger RNAs.

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-205a-5p
  2. Anolis carolinensis aca-miR-205a
  3. Ateles geoffroyi age-miR-205
  4. Bos taurus bta-miR-205
  5. Callorhinchus milii (elephant shark) Cmi-Mir-205-P4_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-205
  7. Capra hircus (goat) miR-205
  8. Cavia porcellus Cpo-Mir-205-P4_5p (mature (guide))
  9. Cervus elaphus (red deer) cel-miR-205
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-205-P4_5p (mature (guide))
  11. Chrysemys picta cpi-miR-205a-5p
  12. Columba livia cli-miR-205a-5p
  13. Cyprinus carpio (common carp) ccr-miR-205
  14. Danio rerio (zebrafish) dre-miR-205-5p
  15. Dasypus novemcinctus Dno-Mir-205-P4_5p (mature (guide))
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-205-P4_5p (mature (guide))
  17. Equus caballus eca-miR-205
  18. Gallus gallus (chicken) gga-miR-205a
  19. Gekko japonicus Gja-Mir-205-P4_5p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-205 (MIR205)
  21. Gorilla gorilla ggo-miR-205
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-205
  23. Lagothrix lagotricha lla-miR-205
  24. Latimeria chalumnae (coelacanth) Lch-Mir-205-P4_5p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-205-P4_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-205
  27. Macaca nemestrina mne-miR-205
  28. Maylandia zebra mze-miR-205
  29. Microcaecilia unicolor Mun-Mir-205-P4_5p (mature (guide))
  30. Monodelphis domestica mdo-miR-205a
  31. Mus musculus (house mouse) mmu-miR-205-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-205
  33. Oreochromis niloticus oni-miR-205
  34. Oryctolagus cuniculus (rabbit) ocu-miR-205-5p
  35. Ovis aries miscellaneous RNA
  36. Pan paniscus (pygmy chimpanzee) ppa-miR-205
  37. Pan troglodytes (chimpanzee) ptr-miR-205
  38. Pongo pygmaeus ppy-miR-205
  39. Pundamilia nyererei pny-miR-205
  40. Python bivittatus (Burmese python) pbv-miR-205a-5p
  41. Rattus norvegicus Rno-Mir-205-P4_5p (mature (guide))
  42. Salmo salar ssa-miR-205b-5p
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P4_5p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-205-P4_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-205-P4_5p (mature (guide))
  46. Sus scrofa ssc-miR-205
  47. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P4_5p (mature (guide))
  48. Takifugu rubripes (torafugu) fru-miR-205
  49. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-205
  50. Tor tambroides (Thai mahseer) miR-205-5p
  51. Xenopus laevis (African clawed frog) xla-miR-205
  52. Xenopus tropicalis (tropical clawed frog) xtr-miR-205a
Publications