Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-205-5p URS0000446722_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (LncBase, MalaCards, IntAct, GeneCards, TarBase, PSICQUIC, miRBase, RefSeq, ENA). Described in 76 papers. Homo sapiens (human) hsa-miR-205-5p sequence is a product of miR-205, miR-205-5p, hsa-miR-205-5p, MIR205, hsa-miR-205 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 123F2, 16E1BP, 17-1A, 2B28, 2H9, 323/A3, 4E-BP1, 4EHP, 4F2, 4F2HC.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-205-5p interacts with:

Interaction id Participant Synonyms
EBI-20563947 intact:EBI-20563711 EBI-20563711 ENSMUST00000172812.2 lncrn_malat1 mouse
EBI-20563906 intact:EBI-20563910 EBI-20563910 ENST00000298910.11 mrna_lrrk2
EBI-25426351 intact:EBI-25426353 EBI-25426353 ENST00000406870 mrna_bcl6
URS0000446722_9606-9 P09038 P09038
URS0000446722_9606-0 P09038 P09038
URS0000446722_9606-10 P11047 P11047
URS0000446722_9606-1 P11047 P11047
URS0000446722_9606-2 P15692 P15692
URS0000446722_9606-11 P15692 P15692
URS0000446722_9606-3 P15692 P15692
URS0000446722_9606-4 P41182 P41182
URS0000446722_9606-12 P41182 P41182
URS0000446722_9606-13 Q01094 Q01094
URS0000446722_9606-5 Q01094 Q01094
URS0000446722_9606-6 Q07954 Q07954
URS0000446722_9606-7 Q07954 Q07954
URS0000446722_9606-8 Q07954 Q07954
URS0000446722_9606-14 Q07954 Q07954

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCUUCAUUCCACCGGAGUCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 79 other species

    1. Alligator mississippiensis ami-miR-205a-5p
    2. Anolis carolinensis aca-miR-205a
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-205
    4. Bos taurus (cattle) bta-miR-205
    5. Canis lupus familiaris (dog) cfa-miR-205
    6. Capra hircus miR-205
    7. Cavia porcellus Cpo-Mir-205-P1_5p (mature (guide))
    8. Cervus elaphus (red deer) cel-miR-205
    9. Chrysemys picta bellii Cpi-Mir-205-P1_5p (mature (guide))
    10. Chrysemys picta cpi-miR-205a-5p
    11. Columba livia cli-miR-205a-5p
    12. Cyprinus carpio (common carp) ccr-miR-205
    13. Danio rerio dre-miR-205-5p
    14. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-205-P1_5p (mature (guide))
    15. Echinops telfairi Ete-Mir-205-P1_5p (mature (guide))
    16. Equus caballus eca-miR-205
    17. Gallus gallus (chicken) gga-miR-205a
    18. Gorilla gorilla (western gorilla) ggo-miR-205
    19. Haplochromis burtoni abu-miR-205
    20. Lagothrix lagotricha (brown woolly monkey) lla-miR-205
    21. Macaca mulatta mml-miR-205
    22. Macaca nemestrina mne-miR-205
    23. Maylandia zebra (zebra mbuna) mze-miR-205
    24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-205a
    25. Mus musculus mmu-miR-205-5p
    26. Neolamprologus brichardi nbr-miR-205
    27. Oreochromis niloticus (Nile tilapia) oni-miR-205
    28. Oryctolagus cuniculus ocu-miR-205-5p
    29. Ovis aries (sheep) miscellaneous RNA
    30. Pan paniscus ppa-miR-205
    31. Pan troglodytes (chimpanzee) ptr-miR-205
    32. Pongo pygmaeus ppy-miR-205
    33. Pundamilia nyererei pny-miR-205
    34. Python bivittatus pbv-miR-205a-5p
    35. Rattus norvegicus Rno-Mir-205-P1_5p (mature (guide))
    36. Salmo salar ssa-miR-205b-5p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-205-P1_5p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-205-P1_5p (mature (guide))
    39. Sus scrofa ssc-miR-205
    40. Taeniopygia guttata (zebra finch) Tgu-Mir-205-P1b_5p (mature (guide))
    41. Takifugu rubripes fru-miR-205
    42. Tetraodon nigroviridis tni-miR-205
    43. Tor tambroides miR-205-5p
    44. Xenopus laevis xla-miR-205
    45. Xenopus tropicalis xtr-miR-205a