Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3) secondary structure diagram

Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3) URS0000415026_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUCUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 824 other species

  1. Acanthisitta chloris tRNA
  2. Acanthochromis polyacanthus tRNA
  3. Accipiter nisus (Eurasian sparrowhawk) tRNA
  4. Acinonyx jubatus (cheetah) tRNA
  5. Acipenser ruthenus (sterlet) tRNA
  6. Acrocephalus arundinaceus (great reed warbler) tRNA
  7. Acromyrmex charruanus tRNA
  8. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gln
  9. Acromyrmex heyeri tRNA
  10. Acropora millepora tRNA-Gln
  11. Acyrthosiphon pisum (Pea aphid) tRNA-Gln
  12. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon CUG)
  13. Aegithalos caudatus tRNA
  14. Aegotheles bennettii tRNA
  15. Ailuropoda melanoleuca tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alca torda tRNA
  19. Ceyx cyanopectus Alcedo cyanopecta tRNA
  20. Aleadryas rufinucha (rufous-naped whistler) tRNA
  21. Alectura lathami (australian brush-turkey) tRNA
  22. Alligator mississippiensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  23. Alligator sinensis (Chinese alligator) tRNA
  24. Alosa alosa (allis shad) tRNA-Gln
  25. Amazona aestiva tRNA
  26. Amazona collaria (yellow-billed parrot) tRNA
  27. Amazona guildingii tRNA
  28. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011386.1
  29. Ameca splendens tRNA-Gln
  30. Ameiurus melas tRNA
  31. Amphiprion ocellaris (clown anemonefish) tRNA
  32. Amphiprion percula tRNA
  33. Amyelois transitella tRNA-Gln
  34. Anabarilius grahami tRNA
  35. Anabas testudineus tRNA
  36. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  37. Anas platyrhynchos tRNA
  38. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon CUG)
  39. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon CUG)
  40. Anas zonorhyncha tRNA
  41. Anguilla anguilla tRNA
  42. Anhinga anhinga tRNA
  43. Anhinga rufa (African darter) tRNA
  44. Anseranas semipalmata (magpie goose) tRNA
  45. Anser brachyrhynchus (pink-footed goose) tRNA
  46. Anser cygnoides (Chinese goose) tRNA
  47. Anthonomus grandis grandis (Boll weevil) transfer RNA glutamine (anticodon CUG)
  48. Anthoscopus minutus tRNA
  49. Aotus nancymaae (Ma's night monkey) tRNA
  50. Apaloderma vittatum tRNA
  51. Aphelocoma coerulescens (scrub jay) tRNA
  52. Aphis glycines (soybean aphid) tRNA
  53. Aphis gossypii (cotton aphid) tRNA
  54. Aptenodytes forsteri (emperor penguin) tRNA
  55. Aptenodytes patagonicus (king penguin) tRNA
  56. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  57. Apteryx owenii (little spotted kiwi) tRNA
  58. Aquila chrysaetos chrysaetos tRNA
  59. Aramus guarauna (limpkin) tRNA
  60. Araneus ventricosus tRNA
  61. Ardeotis kori tRNA
  62. Arenaria interpres (ruddy turnstone) tRNA
  63. Argiope bruennichi tRNA
  64. Asarcornis scutulata tRNA
  65. Astyanax mexicanus tRNA
  66. Ataeniobius toweri tRNA-Gln
  67. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005011523.1
  68. Athene cunicularia tRNA
  69. Atlantisia rogersi (inaccessible island rail) tRNA
  70. Atractosteus spatula (alligator gar) tRNA
  71. Atrichornis clamosus tRNA
  72. Atta cephalotes tRNA LOC105616954-4
  73. Atta colombica tRNA
  74. Austrofundulus limnaeus tRNA
  75. Aythya fuligula (tufted duck) tRNA
  76. Bactrocera dorsalis tRNA-Gln
  77. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  78. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon CUG)
  79. Bactrocera tryoni (Queensland fruitfly) tRNA-Gln
  80. Bagarius yarrelli (goonch) tRNA
  81. Balaeniceps rex (shoebill) tRNA
  82. Balaenoptera acutorostrata scammoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  83. Balaenoptera musculus (Blue whale) tRNA
  84. Balaenoptera physalus (Fin whale) tRNA
  85. Balearica regulorum gibbericeps tRNA
  86. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  87. Baryphthengus martii tRNA
  88. Betta splendens (Siamese fighting fish) tRNA
  89. Bicyclus anynana tRNA-Gln
  90. Biomphalaria glabrata tRNA tRNA-Gln
  91. Biomphalaria pfeifferi tRNA-Gln
  92. Bison bison bison (north american plains bison) tRNA
  93. Bombycilla garrulus tRNA
  94. Bombyx mandarina tRNA-Gln
  95. Bombyx mori tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  96. Bos grunniens (domestic yak) tRNA
  97. Bos mutus Bos grunniens mutus tRNA
  98. Bos indicus tRNA
  99. Bos indicus x Bos taurus (hybrid cattle) tRNA
  100. Bos taurus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  101. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  102. Brenthis ino (lesser marbled fritillary) tRNA
  103. Bubo bubo tRNA
  104. Bucco capensis (collared puffbird) tRNA
  105. Buceros rhinoceros silvestris tRNA
  106. Bucorvus abyssinicus tRNA
  107. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  108. Burhinus bistriatus tRNA
  109. Buteo japonicus tRNA
  110. Caerostris darwini tRNA-Gln
  111. Caerostris extrusa tRNA-Gln
  112. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  113. Alaudala cheleensis Calandrella cheleensis tRNA
  114. Calcarius ornatus tRNA
  115. Callaeas wilsoni (north island kokako) tRNA
  116. Callipepla squamata (scaled quail) tRNA
  117. Callithrix jacchus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  118. Callorhinchus milii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  119. Callorhinus ursinus (northern fur seal) tRNA
  120. Callosobruchus analis hypothetical protein
  121. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  122. Caloenas nicobarica tRNA
  123. Calonectris borealis (cory's shearwater) tRNA
  124. Calypte anna (Anna's hummingbird) tRNA
  125. Calyptomena viridis (green broadbill) tRNA
  126. Camarhynchus parvulus tRNA
  127. Camelus bactrianus (Bactrian camel) tRNA
  128. Camelus dromedarius (Arabian camel) tRNA
  129. Camelus ferus (Wild Bactrian camel) tRNA
  130. Campylorhamphus procurvoides tRNA
  131. Candidula unifasciata tRNA
  132. Canis lupus dingo (dingo) tRNA
  133. Canis lupus familiaris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  134. Capra hircus (goat) tRNA
  135. Antrostomus carolinensis tRNA
  136. Carassius auratus (goldfish) tRNA
  137. Cardinalis cardinalis tRNA
  138. Cariama cristata (red-legged seriema) tRNA
  139. Carlito syrichta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  140. Castor canadensis (American beaver) tRNA
  141. Catagonus wagneri (Chacoan peccary) tRNA
  142. Cathartes aura (turkey vulture) tRNA
  143. Catharus fuscescens tRNA
  144. Catharus ustulatus tRNA
  145. Cavia porcellus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  146. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  147. Cebus imitator (Panamanian white-faced capuchin) tRNA
  148. Centropus unirufus tRNA
  149. Cephalopterus ornatus (amazonian umbrellabird) tRNA
  150. Cephus cinctus (wheat stem sawfly) tRNA
  151. Cepphus grylle tRNA
  152. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gln
  153. Ceratotherium simum simum tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  154. Cercocebus atys (sooty mangabey) tRNA
  155. Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  156. Certhia brachydactyla tRNA
  157. Certhia familiaris tRNA
  158. Cervus elaphus hippelaphus tRNA
  159. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  160. Cettia cetti tRNA
  161. Chaetops frenatus (Rufous rock-jumper) tRNA
  162. Chaetorhynchus papuensis (pygmy drongo) tRNA
  163. Chaetura pelagica (chimney swift) tRNA
  164. Channa argus (snakehead) tRNA
  165. Chanos chanos (milkfish) tRNA
  166. Characodon lateralis tRNA-Gln
  167. Charadrius vociferus tRNA
  168. Chauna torquata (southern screamer) tRNA
  169. Chelonia mydas (green seaturtle) tRNA
  170. Chelydra serpentina (snapping turtle) tRNA
  171. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  172. Chinchilla lanigera tRNA
  173. Chionis minor (black-faced sheathbill) tRNA
  174. Chlamydotis macqueenii Chlamydotis undulata macqueenii tRNA
  175. Chlorocebus sabaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  176. Chloroceryle aenea tRNA
  177. Chloropsis cyanopogon tRNA
  178. Chloropsis hardwickii tRNA
  179. Choloepus hoffmanni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  180. Chordeiles acutipennis (lesser nighthawk) tRNA
  181. Chrysemys picta bellii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  182. Chrysochloris asiatica tRNA
  183. Chrysodeixis includens tRNA
  184. Chrysolophus pictus (golden pheasant) tRNA
  185. Chunga burmeisteri (black-legged seriema) tRNA
  186. Ciccaba nigrolineata tRNA
  187. Ciconia maguari tRNA
  188. Cinclus mexicanus tRNA
  189. Circaetus pectoralis tRNA
  190. Cisticola juncidis tRNA
  191. Clarias magur (asian catfish) tRNA
  192. Climacteris rufus Climacteris rufa (rufous treecreeper) tRNA
  193. Cnemophilus loriae (Loria's bird-of-paradise) tRNA
  194. Cochlearius cochlearius tRNA
  195. Colinus virginianus tRNA
  196. Colius striatus tRNA
  197. Collichthys lucidus tRNA
  198. Colobus angolensis palliatus tRNA
  199. Columba livia tRNA
  200. Columbina picui (picui ground-dove) tRNA
  201. Conger conger tRNA
  202. Copidosoma floridanum (Parasitoid wasp) tRNA-Gln
  203. Copsychus sechellarum tRNA
  204. Cordylochernes scorpioides tRNA-Gln
  205. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015377.1
  206. Corvus brachyrhynchos (American crow) tRNA
  207. Corvus moneduloides (new caledonian crow) tRNA
  208. Corythaeola cristata (great blue turaco) tRNA
  209. Corythaixoides concolor (grey go-away-bird) tRNA
  210. Cottoperca gobio tRNA
  211. Coturnix japonica (Japanese quail) tRNA
  212. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  213. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  214. Magallana gigas (Pacific oyster) tRNA-Gln for anticodon CUG
  215. Crassostrea virginica (Eastern oyster) tRNA-Gln
  216. Crenichthys baileyi tRNA-Gln
  217. Cricetulus griseus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  218. Crocodylus porosus (Australian saltwater crocodile) tRNA
  219. Crocuta crocuta (spotted hyena) tRNA
  220. Crotophaga sulcirostris (groove-billed ani) tRNA
  221. Crypturellus soui tRNA
  222. Crypturellus undulatus tRNA
  223. Ctenocephalides felis (Cat flea) tRNA-Gln
  224. Cuculus canorus tRNA
  225. Cyanistes caeruleus tRNA
  226. Cyclopterus lumpus tRNA
  227. Cylas formicarius (Sweet potato weevil) transfer RNA glutamine (anticodon CUG)
  228. Cynoglossus semilaevis (tongue sole) tRNA
  229. Cyphomyrmex costatus tRNA
  230. Cyprinodon variegatus tRNA
  231. Cyprinus carpio carpio tRNA
  232. Cyprinus carpio (common carp) tRNA
  233. Danaus chrysippus (African queen) tRNA
  234. Danaus plexippus plexippus tRNA
  235. Danionella cerebrum tRNA-Gln
  236. Danionella translucida tRNA
  237. Danio rerio tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 58)
  238. Daphoenositta chrysoptera (varied sittella) tRNA
  239. Dasyornis broadbenti (rufous bristle-bird) tRNA
  240. Dasypus novemcinctus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  241. Daubentonia madagascariensis tRNA-Gln
  242. Delphinapterus leucas (beluga whale) tRNA
  243. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  244. Denticeps clupeoides (denticle herring) tRNA
  245. Diatraea saccharalis (sugarcane borer) tRNA
  246. Dicaeum eximium tRNA
  247. Dicentrarchus labrax (European seabass) tRNA
  248. Diceros bicornis minor tRNA
  249. Dicrurus megarhynchus tRNA
  250. Dinoponera quadriceps (south american ant) tRNA
  251. Dipodomys ordii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  252. Dissostichus mawsoni tRNA
  253. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  254. Donacobius atricapilla tRNA
  255. Dromaius novaehollandiae (emu) tRNA
  256. Dromas ardeola tRNA
  257. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon CUG)
  258. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  259. Drosophila arizonae (Fruit fly) tRNA-Gln
  260. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  261. Drosophila bipectinata (Fruit fly) tRNA-Gln
  262. Drosophila busckii (Fruit fly) tRNA-Gln
  263. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  264. Drosophila eugracilis (Fruit fly) tRNA-Gln
  265. Drosophila ficusphila (Fruit fly) tRNA-Gln
  266. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  267. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  268. Drosophila hydei (Fruit fly) tRNA-Gln
  269. Drosophila innubila (Fruit fly) tRNA-Gln
  270. Drosophila kikkawai (Fruit fly) tRNA-Gln
  271. Drosophila mauritiana (Fruit fly) tRNA-Gln
  272. Drosophila melanogaster transfer RNA:Glutamine-CTG 1-1 (Dmel_CR30237)
  273. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  274. Drosophila navojoa (Fruit fly) tRNA-Gln
  275. Drosophila santomea (Fruit fly) tRNA-Gln
  276. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  277. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  278. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  279. Drosophila suzukii (Fruit fly) tRNA-Gln
  280. Drosophila takahashii (Fruit fly) tRNA-Gln
  281. Drosophila teissieri (Fruit fly) tRNA-Gln
  282. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  283. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  284. Drymodes brunneopygia tRNA
  285. Dryococelus australis tRNA-OTHER
  286. Dryoscopus gambensis tRNA
  287. Echeneis naucrates (live sharksucker) tRNA
  288. Echinops telfairi tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  289. Edolisoma coerulescens tRNA
  290. Egretta garzetta tRNA
  291. Elachura formosa (spotted wren-babbler) tRNA
  292. Electrophorus electricus (electric eel) tRNA
  293. Elysia chlorotica (eastern emerald elysia) tRNA
  294. Emberiza fucata tRNA
  295. Enhydra lutris kenyoni tRNA
  296. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  297. Eptatretus burgeri (inshore hagfish) tRNA
  298. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  299. Equus asinus (ass) tRNA
  300. Equus caballus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  301. Erinaceus europaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  302. Erithacus rubecula (European robin) tRNA
  303. Erpetoichthys calabaricus (reedfish) tRNA
  304. Erpornis zantholeuca tRNA
  305. Erythrocercus mccallii tRNA
  306. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  307. Etheostoma spectabile (orangethroat darter) tRNA
  308. Eubucco bourcierii (red-headed barbet) tRNA
  309. Eudromia elegans (elegant crested-tinamou) tRNA
  310. Eudyptes chrysocome (Rockhopper penguin) tRNA
  311. Eudyptula minor (little blue penguin) tRNA
  312. Eulacestoma nigropectus (wattled ploughbill) tRNA
  313. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  314. Eurypyga helias (sunbittern) tRNA
  315. Eurystomus gularis tRNA
  316. Exocentrus adspersus tRNA-Gln
  317. Falco tinnunculus (common kestrel) tRNA
  318. Falcunculus frontatus (crested shrike-tit) tRNA
  319. Felis catus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  320. Ficedula albicollis tRNA
  321. Formicarius rufipectus tRNA
  322. Fregata magnificens tRNA
  323. Fregetta grallaria tRNA
  324. Frieseomelitta varia tRNA
  325. Fukomys damarensis (Damara mole-rat) tRNA
  326. Fulmarus glacialis (northern fulmar) tRNA
  327. Furnarius figulus tRNA
  328. Galbula dea tRNA
  329. Galemys pyrenaicus tRNA
  330. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  331. Galleria mellonella tRNA-Gln
  332. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  333. Gallus gallus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  334. Gambusia affinis (western mosquitofish) tRNA
  335. Gasterosteus aculeatus (three-spined stickleback) tRNA
  336. Gavia stellata tRNA
  337. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  338. Geococcyx californianus tRNA
  339. Geospiza fortis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  340. Geotrypetes seraphini tRNA
  341. Glareola pratincola tRNA
  342. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  343. Glossina austeni tRNA tRNA-Gln
  344. Glossina brevipalpis tRNA tRNA-Gln
  345. Glossina fuscipes fuscipes tRNA
  346. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  347. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gln
  348. Glossina palpalis gambiensis tRNA tRNA-Gln
  349. Goodea atripinnis tRNA-Gln
  350. Gopherus agassizii (desert tortoise) tRNA
  351. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  352. Gorilla gorilla gorilla tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  353. Gouania willdenowi (blunt-snouted clingfish) tRNA
  354. Grallaria varia (variegated antpitta) tRNA
  355. Grantiella picta tRNA
  356. Grus americana (whooping crane) tRNA
  357. Gulo gulo (wolverine) tRNA
  358. Gymnodraco acuticeps tRNA
  359. Halcyon senegalensis tRNA
  360. Haliaeetus albicilla (white-tailed eagle) tRNA
  361. Haplochromis burtoni tRNA
  362. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  363. Heliconius melpomene (Postman butterfly) tRNA HMEL017634
  364. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon CUG)
  365. Helicoverpa zea (Corn earworm) tRNA-Gln
  366. Heliornis fulica (sungrebe) tRNA
  367. Heliothis virescens (tobacco budworm) tRNA
  368. Hemibagrus wyckioides tRNA
  369. Hemiprocne comata tRNA
  370. Henosepilachna vigintioctopunctata tRNA-Gln
  371. Herpetotheres cachinnans tRNA
  372. Heterocephalus glaber tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  373. Himantopus himantopus (black-winged stilt) tRNA
  374. Hippoglossus stenolepis tRNA-Gln
  375. Hippolais icterina (icterine warbler) tRNA
  376. Hipposideros armiger tRNA
  377. Hirundo rustica (Barn swallow) tRNA
  378. Hirundo rustica rustica tRNA
  379. Homalodisca vitripennis tRNA-Gln
  380. Homo sapiens tRNA-Gln (anticodon CTG) 1-1 (TRQ-CTG1 1 to 5)
  381. Horornis vulcanius tRNA
  382. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon CUG)
  383. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon CUG)
  384. Hylia prasina (green hylia) tRNA
  385. Hymenochirus boettgeri tRNA
  386. Hypocryptadius cinnamomeus tRNA
  387. Ibidorhyncha struthersii tRNA
  388. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005012187.1
  389. Ictidomys tridecemlineatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  390. Ifrita kowaldi (blue-capped ifrita) tRNA
  391. Ignelater luminosus (cucubano) tRNA
  392. Illadopsis cleaveri (blackcap illadopsis) tRNA
  393. Ilyodon furcidens tRNA-Gln
  394. Indicator maculatus tRNA
  395. Irena cyanogastra Irena cyanogaster tRNA
  396. Jacana jacana (wattled jacana) tRNA
  397. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  398. Junco hyemalis (dark-eyed junco) tRNA
  399. Kryptolebias marmoratus (mangrove rivulus) tRNA
  400. Labeo rohita (rohu) tRNA
  401. Labrus bergylta (ballan wrasse) tRNA
  402. Lamprotornis superbus tRNA
  403. Lanius ludovicianus tRNA
  404. Larimichthys crocea tRNA
  405. Larus smithsonianus tRNA
  406. Lates calcarifer (barramundi perch) tRNA
  407. Laticauda laticaudata (blue-ringed sea krait) tRNA
  408. Latimeria chalumnae tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  409. Leguminivora glycinivorella tRNA-Gln
  410. Leiothrix lutea (red-billed leiothrix) tRNA
  411. Lepidothrix coronata tRNA
  412. Lepisosteus oculatus (spotted gar) tRNA
  413. Leptidea sinapis tRNA
  414. Leptinotarsa decemlineata tRNA-Gln
  415. Leptobrachium leishanense (Leishan spiny toad) tRNA
  416. Leptocoma aspasia tRNA
  417. Leptonychotes weddellii (Weddell seal) tRNA
  418. Leptosomus discolor tRNA
  419. Leucopsar rothschildi tRNA
  420. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068927.1
  421. Limulus polyphemus tRNA-Gln
  422. Lingula anatina (Lamp shell) tRNA-Gln
  423. Lipotes vexillifer (Yangtze River dolphin) tRNA
  424. Helopsaltes ochotensis Locustella ochotensis tRNA
  425. Lonchura striata domestica (Bengalese finch) tRNA
  426. Lophotis ruficrista tRNA
  427. Loxia curvirostra tRNA
  428. Loxia leucoptera tRNA
  429. Loxodonta africana tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  430. Lucilia cuprina tRNA-Gln for anticodon CUG
  431. Lutzomyia longipalpis tRNA tRNA-Gln
  432. Lynx canadensis (Canada lynx) tRNA
  433. Lynx pardinus (Spanish lynx) tRNA
  434. Macaca fascicularis (crab-eating macaque) tRNA
  435. Macaca mulatta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  436. Macaca nemestrina (pig-tailed macaque) tRNA
  437. Machaerirhynchus nigripectus tRNA
  438. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011443.1
  439. Malurus cyaneus samueli tRNA
  440. Malurus elegans (Red-winged fairywren) tRNA
  441. Manacus vitellinus (golden-collared manakin) tRNA
  442. Mandrillus leucophaeus (drill) tRNA
  443. Manduca sexta tRNA-Gln
  444. Marmota marmota marmota (Alpine marmot) tRNA
  445. Marmota monax tRNA
  446. Mastacembelus armatus tRNA
  447. Mauremys mutica tRNA
  448. Maylandia zebra (zebra mbuna) tRNA
  449. Megachile rotundata tRNA-Gln
  450. Megalops atlanticus (tarpon) tRNA
  451. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  452. Melanocharis versteri (fan-tailed berrypecker) tRNA
  453. Meleagris gallopavo tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  454. Melipona bicolor tRNA
  455. Melitaea cinxia misc RNA ENSMCXG00005023534.1
  456. Melopsittacus undulatus (budgerigar) tRNA
  457. Melospiza melodia (song sparrow) tRNA
  458. Menidia menidia (Atlantic silverside) tRNA
  459. Menura novaehollandiae (superb lyrebird) tRNA
  460. Merluccius polli (Benguela hake) tRNA
  461. Merops nubicus tRNA
  462. Mesembrinibis cayennensis tRNA
  463. Mesitornis unicolor (brown roatelo) tRNA
  464. Mesocricetus auratus (golden hamster) tRNA
  465. Microcaecilia unicolor tRNA
  466. Microcebus murinus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  467. Microtus ochrogaster (prairie vole) tRNA
  468. Mimus melanotis tRNA-Gln
  469. Mionectes macconnelli (McConnell's flycatcher) tRNA
  470. Mohoua ochrocephala tRNA
  471. Mola mola (ocean sunfish) tRNA
  472. Molorchus minor tRNA-Gln
  473. Molossus molossus (Pallas's mastiff bat) tRNA
  474. Molothrus ater tRNA
  475. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  476. Monodelphis domestica tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  477. Monodon monoceros (narwhal) tRNA
  478. Monomorium pharaonis tRNA-Gln
  479. Moschus moschiferus (Siberian musk deer) tRNA
  480. Motacilla alba tRNA
  481. Muntiacus reevesi (Chinese muntjac) tRNA
  482. Musca domestica tRNA MDOA005923
  483. Mus caroli tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  484. Mus musculus castaneus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  485. Mus musculus domesticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  486. Mus musculus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  487. Mus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4, tRNA-Gln-CTG-3 1 to 4)
  488. Mus pahari tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  489. Mus spicilegus (steppe mouse) tRNA
  490. Mus spretus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  491. Mustela putorius furo tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  492. Myiagra hebetior tRNA
  493. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013047.1
  494. Myotis brandtii tRNA
  495. Myotis davidii tRNA
  496. Myotis lucifugus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  497. Myotis myotis tRNA
  498. Myripristis murdjan (pinecone soldierfish) tRNA
  499. Mystacornis crossleyi tRNA
  500. Mytilus californianus (California mussel) transfer RNA glutamine (anticodon CUG)
  501. Mytilus coruscus tRNA
  502. Mytilus edulis tRNA
  503. Mytilus galloprovincialis tRNA
  504. Naja naja tRNA
  505. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  506. Nasonia vitripennis tRNA-Gln
  507. Neodrepanis coruscans (wattled asity) tRNA
  508. Neogobius melanostomus (round goby) tRNA
  509. Neolamprologus brichardi tRNA
  510. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  511. Neopipo cinnamomea tRNA
  512. Neotoma lepida (desert woodrat) tRNA
  513. Neogale vison Neovison vison tRNA
  514. Nephila pilipes tRNA
  515. Nesidiocoris tenuis tRNA
  516. Nesospiza acunhae tRNA
  517. Nestor notabilis tRNA
  518. Nicator chloris tRNA
  519. Nipponia nippon (crested ibis) tRNA
  520. Nomascus leucogenys tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  521. Notamacropus eugenii tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  522. Notechis scutatus tRNA
  523. Nothobranchius furzeri tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  524. Nothocercus julius tRNA
  525. Nothoprocta ornata tRNA
  526. Nothoprocta perdicaria tRNA
  527. Notiomystis cincta tRNA
  528. Notothenia coriiceps (black rockcod) tRNA
  529. Nyctereutes procyonoides (raccoon dog) tRNA
  530. Nyctibius bracteatus tRNA
  531. Nyctibius grandis tRNA
  532. Nycticryphes semicollaris tRNA
  533. Nyctiprogne leucopyga tRNA
  534. Oceanites oceanicus tRNA
  535. Oceanodroma tethys tRNA
  536. Ochotona princeps tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  537. Octodon degus (degu) tRNA
  538. Odobenus rosmarus divergens (Pacific walrus) tRNA
  539. Odocoileus virginianus texanus tRNA
  540. Odontophorus gujanensis (marbled wood quail) tRNA
  541. Oenanthe oenanthe (Northern wheatear) tRNA
  542. Onychorhynchus coronatus tRNA
  543. Onychostoma macrolepis tRNA
  544. Ooceraea biroi tRNA-Gln
  545. Ophiophagus hannah tRNA
  546. Opisthocomus hoazin tRNA
  547. Oreocharis arfaki tRNA
  548. Oreochromis aureus tRNA
  549. Oreochromis niloticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  550. Oreotrochilus melanogaster tRNA
  551. Origma solitaria tRNA
  552. Oriolus oriolus tRNA
  553. Ornithorhynchus anatinus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  554. Orthonyx spaldingii (northern chowchilla) tRNA
  555. Orussus abietinus (Parasitic wood wasp) tRNA-Gln
  556. Orycteropus afer afer tRNA
  557. Oryctolagus cuniculus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  558. Oryzias javanicus tRNA
  559. Oryzias latipes tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  560. Oryzias melastigma (Indian medaka) tRNA
  561. Oryzias sinensis tRNA
  562. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon CUG)
  563. Otolemur garnettii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  564. Otus sunia (Oriental scops-owl) tRNA
  565. Ovis aries tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  566. Oxyruncus cristatus (sharpbill) tRNA
  567. Pachycephala philippinensis tRNA
  568. Pachyramphus minor tRNA
  569. Pandion haliaetus tRNA
  570. Pangasianodon gigas tRNA-Gln
  571. Pangasianodon hypophthalmus tRNA
  572. Pangasius djambal tRNA-Gln
  573. Pan paniscus (pygmy chimpanzee) tRNA
  574. Panthera leo (lion) tRNA
  575. Panthera tigris altaica (Amur tiger) tRNA
  576. Pantherophis guttatus tRNA
  577. Pan troglodytes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  578. Panurus biarmicus tRNA
  579. Papilio machaon tRNA
  580. Papilio xuthus tRNA
  581. Papio anubis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  582. Sinosuthora webbiana Paradoxornis webbianus tRNA
  583. Arctia plantaginis Parasemia plantaginis tRNA
  584. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  585. Pardalotus punctatus (spotted pardalote) tRNA
  586. Parnassius apollo (apollo) tRNA
  587. Passerina amoena tRNA
  588. Patagioenas fasciata monilis tRNA
  589. Pavo cristatus (Indian peafowl) tRNA
  590. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon CUG)
  591. Pelecanoides urinatrix tRNA
  592. Pelecanus crispus tRNA
  593. Pelobates cultripes tRNA.Gln
  594. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  595. Pelusios castaneus tRNA
  596. Penelope pileata tRNA
  597. Perca flavescens tRNA
  598. Perca fluviatilis tRNA
  599. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  600. Peucedramus taeniatus (olive warbler) tRNA
  601. Phaethon lepturus tRNA
  602. Phaetusa simplex (large-billed tern) tRNA
  603. Phainopepla nitens tRNA
  604. Phalacrocorax carbo (great cormorant) tRNA
  605. Phascolarctos cinereus (koala) tRNA
  606. Phasianus colchicus (Ring-necked pheasant) tRNA
  607. Pheucticus melanocephalus tRNA
  608. Phlebotomus argentipes (Sand fly) transfer RNA glutamine (anticodon CUG)
  609. Phlebotomus papatasi tRNA tRNA-Gln
  610. Phocoena sinus (vaquita) tRNA
  611. Phoenicopterus ruber ruber tRNA
  612. Photinus pyralis (common eastern firefly) tRNA
  613. Phrynocephalus forsythii tRNA
  614. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  615. Phyllostomus discolor (pale spear-nosed bat) tRNA
  616. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  617. Piaya cayana (squirrel cuckoo) tRNA
  618. Picathartes gymnocephalus tRNA
  619. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  620. Pieris brassicae (large cabbage white) tRNA
  621. Pieris macdunnoughi tRNA
  622. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  623. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  624. Pipra filicauda tRNA
  625. Piprites chloris (white-winged piprites) tRNA
  626. Pitta sordida (hooded pitta) tRNA
  627. Platysteira castanea tRNA
  628. Platysternon megacephalum (big-headed turtle) tRNA
  629. Plecturocebus cupreus tRNA-OTHER
  630. Ploceus nigricollis tRNA
  631. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon CUG)
  632. Plutella xylostella (diamondback moth) tRNA
  633. Pluvianellus socialis (magellanic plover) tRNA
  634. Podarcis lilfordi tRNA
  635. Podarcis muralis tRNA
  636. Podargus strigoides (tawny frogmouth) tRNA
  637. Podiceps cristatus (great crested grebe) tRNA
  638. Podilymbus podiceps tRNA
  639. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  640. Poecilia formosa tRNA
  641. Poecilia reticulata (guppy) tRNA
  642. Pogona vitticeps (central bearded dragon) tRNA
  643. Polioptila caerulea tRNA
  644. Polypterus senegalus tRNA
  645. Pomacea canaliculata tRNA-Gln
  646. Pomatorhinus ruficollis tRNA
  647. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  648. Pongo abelii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  649. Potamilus streckersoni tRNA-Gln
  650. Probosciger aterrimus tRNA
  651. Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  652. Prolemur simus (greater bamboo lemur) tRNA
  653. Promerops cafer (Cape sugarbird) tRNA
  654. Propithecus coquereli (Coquerel's sifaka) tRNA
  655. Prunella fulvescens tRNA
  656. Prunella himalayana tRNA
  657. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  658. Pseudoatta argentina tRNA
  659. Pseudomonas sp. PHC1 tRNA-Gln
  660. Pseudonaja textilis tRNA
  661. Psilopogon haemacephalus tRNA
  662. Psophia crepitans (common trumpeter) tRNA
  663. Pterocles burchelli tRNA
  664. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  665. Pteropus alecto (black flying fox) tRNA
  666. Pteropus vampyrus (large flying fox) tRNA
  667. Pteruthius melanotis tRNA
  668. Ptilonorhynchus violaceus (satin bowerbird) tRNA
  669. Ptilorrhoa leucosticta tRNA
  670. Puma concolor (puma) tRNA
  671. Pundamilia nyererei tRNA
  672. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  673. Pycnonotus jocosus tRNA
  674. Pygoscelis adeliae (Adelie penguin) tRNA
  675. Pygoscelis papua tRNA
  676. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  677. Quiscalus mexicanus tRNA
  678. Ramphastos sulfuratus tRNA
  679. Aquarana catesbeiana Rana catesbeiana (bullfrog) tRNA
  680. Rattus norvegicus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2, tRNA-Gln-CTG-4-1)
  681. Regulus satrapa (golden-crowned kinglet) tRNA
  682. Rhabdornis inornatus tRNA
  683. Rhadina sibilatrix tRNA
  684. Rhagoletis pomonella tRNA-Gln
  685. Rhagologus leucostigma tRNA
  686. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  687. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  688. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  689. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  690. Rhipidura dahli tRNA
  691. Rhodinocichla rosea tRNA
  692. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  693. Rhynchophorus ferrugineus (red palm weevil) tRNA
  694. Rhynochetos jubatus (kagu) tRNA
  695. Rissa tridactyla (black-legged kittiwake) tRNA
  696. Rostratula benghalensis (greater painted-snipe) tRNA
  697. Rousettus aegyptiacus (Egyptian rousette) tRNA
  698. Rynchops niger (black skimmer) tRNA
  699. Sagittarius serpentarius tRNA
  700. Saimiri boliviensis boliviensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  701. Sakesphorus luctuosus tRNA
  702. Salarias fasciatus (jewelled blenny) tRNA
  703. Sander lucioperca (pike-perch) tRNA
  704. Sapayoa aenigma (broad-billed sapayoa) tRNA
  705. Sarcophilus harrisii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  706. Sciurus carolinensis (gray squirrel) tRNA
  707. Sciurus vulgaris (Eurasian red squirrel) tRNA
  708. Scleropages formosus tRNA
  709. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  710. Scophthalmus maximus (turbot) tRNA
  711. Scopus umbretta (hamerkop) tRNA
  712. Scyliorhinus torazame (cloudy catshark) tRNA
  713. Scytalopus superciliaris tRNA
  714. Semnornis frantzii tRNA
  715. Serilophus lunatus (silver-breasted broadbill) tRNA
  716. Serinus canaria (common canary) tRNA
  717. Sigmodon hispidus tRNA-Gln
  718. Silurus meridionalis tRNA
  719. Sinocyclocheilus anshuiensis tRNA
  720. Sinocyclocheilus grahami tRNA
  721. Sinocyclocheilus rhinocerous tRNA
  722. Sitophilus oryzae (Rice weevil) tRNA-Gln
  723. Sitta europaea (wood nuthatch) tRNA
  724. Smithornis capensis tRNA
  725. Solenopsis invicta (red fire ant) tRNA
  726. Sorex araneus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  727. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  728. Sparus aurata (gilthead seabream) tRNA
  729. Spermophilus dauricus (Daurian ground squirrel) tRNA
  730. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  731. Sphaeramia orbicularis tRNA
  732. Sphaerodactylus townsendi tRNA-Gln
  733. Sphenodon punctatus (tuatara) tRNA
  734. Spizaetus tyrannus (black hawk-eagle) tRNA
  735. Spizella passerina (chipping sparrow) tRNA
  736. Spodoptera exigua (beet armyworm) tRNA
  737. Spodoptera frugiperda tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  738. Spodoptera littoralis tRNA
  739. Spodoptera litura tRNA
  740. Steatornis caripensis (oilbird) tRNA
  741. Stegastes partitus (bicolor damselfish) tRNA
  742. Stegodyphus dumicola (Social spider) tRNA-Gln
  743. Stegodyphus mimosarum tRNA-Gln for anticodon CUG
  744. Stercorarius parasiticus tRNA
  745. Sterrhoptilus dennistouni tRNA
  746. Stomoxys calcitrans tRNA-Gln
  747. Strigops habroptila (kakapo) tRNA
  748. Strix occidentalis caurina tRNA
  749. Struthidea cinerea tRNA
  750. Struthio camelus australis tRNA
  751. Sula dactylatra tRNA
  752. Suricata suricatta (meerkat) tRNA
  753. Sus scrofa tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  754. Sylvia atricapilla (blackcap) tRNA
  755. Sylvia borin tRNA
  756. Sylvietta virens (green crombec) tRNA
  757. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  758. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  759. Tachuris rubrigastra tRNA
  760. Taeniopygia guttata tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  761. Takifugu bimaculatus tRNA
  762. Takifugu flavidus tRNA
  763. Takifugu rubripes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  764. Temnothorax curvispinosus tRNA
  765. Temnothorax longispinosus tRNA
  766. Tenebrio molitor (yellow mealworm) tRNA
  767. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  768. Tetraodon nigroviridis tRNA
  769. Thalassarche chlororhynchos tRNA
  770. Thamnophis sirtalis tRNA
  771. Theropithecus gelada (gelada baboon) tRNA
  772. Thinocorus orbignyianus tRNA
  773. Thryothorus ludovicianus tRNA
  774. Tichodroma muraria tRNA
  775. Tinamus guttatus tRNA
  776. Todus mexicanus (puerto rican tody) tRNA
  777. Toxostoma redivivum tRNA
  778. Trachymyrmex cornetzi tRNA
  779. Trachymyrmex septentrionalis tRNA
  780. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  781. Trichechus manatus latirostris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  782. Trichogramma brassicae tRNA
  783. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  784. Tricholaema leucomelas (pied barbet) tRNA
  785. Trichomalopsis sarcophagae tRNA
  786. Trichonephila clavata (joro spider) tRNA
  787. Trichonephila clavipes (golden silk orbweaver) tRNA
  788. Trichonephila inaurata madagascariensis tRNA
  789. Trichoplusia ni (cabbage looper) tRNA
  790. Triplophysa rosa (cave loach) tRNA
  791. Triplophysa tibetana tRNA
  792. Trogon melanurus (black-tailed trogon) tRNA
  793. Tropilaelaps mercedesae tRNA
  794. Tupaia chinensis (Chinese tree shrew) tRNA
  795. Salvator merianae Tupinambis merianae tRNA
  796. Turnix velox (little buttonquail) tRNA
  797. Tursiops truncatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  798. Tyrannus savana (fork-tailed flycatcher) tRNA
  799. Tyto alba tRNA
  800. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon CUG)
  801. Upupa epops (Eurasian hoopoe) tRNA
  802. Urocolius indicus tRNA
  803. Urocynchramus pylzowi tRNA
  804. Ursus americanus (American black bear) tRNA
  805. Ursus maritimus (polar bear) tRNA
  806. Vanessa tameamea tRNA
  807. Varanus komodoensis tRNA
  808. Varroa destructor (Honeybee mite) tRNA-Gln
  809. Varroa jacobsoni (Varroa mite) tRNA-Gln
  810. Venturia canescens (Endoparasitoid wasp) tRNA-Gln
  811. Vicugna pacos tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  812. Vidua chalybeata tRNA
  813. Vidua macroura tRNA
  814. Vireo altiloquus (black-whiskered vireo) tRNA
  815. Vombatus ursinus (common wombat) tRNA
  816. Vulpes vulpes (red fox) tRNA
  817. Xenoophorus captivus tRNA-Gln
  818. Xenopus laevis (African clawed frog) tRNA
  819. Xenopus tropicalis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 31)
  820. Xenotaenia resolanae tRNA-Gln
  821. Xiphophorus maculatus (southern platyfish) tRNA
  822. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  823. Zapornia atra tRNA
  824. Zerene cesonia (Southern Dogface) tRNA-Gln
  825. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon CUG)
  826. Zonotrichia albicollis tRNA
  827. Zophobas morio tRNA
  828. Zosterops borbonicus tRNA
  829. Zosterops hypoxanthus tRNA
  830. Zosterops lateralis melanops tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications