Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4) secondary structure diagram

Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4) URS0000415026_9813

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUCUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 263 other species

  1. Acanthisitta chloris tRNA
  2. Acromyrmex echinatior tRNA-Gln
  3. Acropora millepora (Stony coral) tRNA-Gln
  4. Acyrthosiphon pisum tRNA-Gln
  5. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon CUG)
  6. Ailuropoda melanoleuca tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  7. Albula glossodonta tRNA-OTHER
  8. Albula goreensis tRNA-Gln
  9. Alligator mississippiensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  10. Alosa alosa tRNA-Gln
  11. Amazona aestiva tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011386.1
  13. Ameiurus melas tRNA-Gln
  14. Amyelois transitella (Naval orange worm) tRNA-Gln
  15. Anas platyrhynchos tRNA
  16. Anguilla anguilla (European eel) tRNA-Gln
  17. Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  18. Anthonomus grandis grandis transfer RNA glutamine (anticodon CUG)
  19. Apaloderma vittatum tRNA
  20. Aptenodytes forsteri tRNA
  21. Astyanax mexicanus tRNA
  22. Ataeniobius toweri tRNA-Gln
  23. Athalia rosae misc RNA ENSAEAG00005011523.1
  24. Atta cephalotes tRNA LOC105616954-4
  25. Atta colombica tRNA
  26. Bactrocera dorsalis (Oriental fruit fly) tRNA-Gln
  27. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  28. Bactrocera tryoni tRNA-Gln
  29. Balaenoptera acutorostrata scammoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  30. Balearica regulorum gibbericeps tRNA
  31. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  32. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Gln
  33. Biomphalaria pfeifferi tRNA-Gln
  34. Bombyx mandarina (Wild silkworm) tRNA-Gln
  35. Bombyx mori tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  36. Bos taurus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  37. Buceros rhinoceros silvestris tRNA
  38. Caerostris darwini tRNA-Gln
  39. Caerostris extrusa tRNA-Gln
  40. Callipepla squamata tRNA
  41. Callithrix jacchus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  42. Callorhinchus milii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  43. Callosobruchus analis hypothetical protein
  44. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  45. Calypte anna tRNA
  46. Camelus ferus tRNA
  47. Canis lupus familiaris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  48. Antrostomus carolinensis tRNA
  49. Cariama cristata tRNA
  50. Carlito syrichta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  51. Cathartes aura tRNA
  52. Cavia porcellus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  53. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gln
  54. Ceratotherium simum simum tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  55. Chaetura pelagica (chimney swift) tRNA
  56. Characodon lateralis tRNA-Gln
  57. Charadrius vociferus tRNA
  58. Chelonia mydas (green seaturtle) tRNA
  59. Chelydra serpentina tRNA-Gln
  60. Chlamydotis macqueenii tRNA
  61. Chlorocebus sabaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  62. Choloepus hoffmanni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  63. Chrysemys picta bellii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  64. Colinus virginianus tRNA
  65. Colius striatus (speckled mousebird) tRNA
  66. Columba livia tRNA
  67. Copidosoma floridanum tRNA-Gln
  68. Cordylochernes scorpioides tRNA-Gln
  69. Corvus brachyrhynchos (American crow) tRNA
  70. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  71. Crassostrea gigas tRNA-Gln for anticodon CUG
  72. Crassostrea virginica tRNA-Gln
  73. Crenichthys baileyi tRNA-Gln
  74. Cricetulus griseus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  75. Cuculus canorus tRNA
  76. Cyphomyrmex costatus tRNA
  77. Danaus plexippus plexippus tRNA
  78. Danionella translucida tRNA-Gln
  79. Danio rerio tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 58)
  80. Dasypus novemcinctus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  81. Dipodomys ordii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  82. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  83. Drosophila busckii tRNA
  84. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  85. Drosophila ficusphila tRNA
  86. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  87. Drosophila gunungcola tRNA-OTHER
  88. Drosophila melanogaster transfer RNA:Glutamine-CTG 1-1 (Dmel_CR30237)
  89. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  90. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  91. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  92. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  93. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  94. Dryococelus australis tRNA-OTHER
  95. Echinops telfairi tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  96. Egretta garzetta tRNA
  97. Eptesicus nilssonii tRNA-Gln
  98. Equus caballus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  99. Erinaceus europaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  100. Eurypyga helias (sunbittern) tRNA
  101. Exocentrus adspersus tRNA-Gln
  102. Felis catus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  103. Ficedula albicollis tRNA
  104. Frieseomelitta varia tRNA-Gln
  105. Fukomys damarensis tRNA
  106. Fulmarus glacialis tRNA
  107. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  108. Galleria mellonella (Greater wax moth) tRNA-Gln
  109. Gallus gallus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  110. Gasterosteus aculeatus tRNA
  111. Gavia stellata tRNA
  112. Geospiza fortis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  113. Glossina austeni tRNA tRNA-Gln
  114. Glossina brevipalpis tRNA tRNA-Gln
  115. Glossina fuscipes fuscipes tRNA
  116. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  117. Glossina pallidipes tRNA tRNA-Gln
  118. Glossina palpalis gambiensis tRNA tRNA-Gln
  119. Gorilla gorilla gorilla tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  120. Haliaeetus albicilla (white-tailed eagle) tRNA
  121. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  122. Heliconius melpomene (Postman butterfly) tRNA HMEL017634
  123. Helicoverpa armigera transfer RNA glutamine (anticodon CUG)
  124. Helicoverpa zea (Corn earworm) tRNA-Gln
  125. Heterocephalus glaber tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  126. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  127. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  128. Homo sapiens tRNA-Gln (anticodon CTG) 1-1 (TRQ-CTG1 1 to 5)
  129. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005012187.1
  130. Ictidomys tridecemlineatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  131. Lamprotornis superbus tRNA-OTHER
  132. Larimichthys crocea tRNA
  133. Latimeria chalumnae tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  134. Leguminivora glycinivorella (Soybean pod borer) tRNA-Gln
  135. Lepisosteus oculatus (spotted gar) tRNA
  136. Leptinotarsa decemlineata tRNA-Gln
  137. Leptosomus discolor tRNA
  138. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000068927.1
  139. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln
  140. Lingula anatina (Lamp shell) tRNA-Gln
  141. Lonchura striata domestica (Bengalese finch) tRNA
  142. Loxodonta africana tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  143. Lucilia cuprina (Australian sheep blowfly) tRNA-Gln for anticodon CUG
  144. Lutzomyia longipalpis tRNA tRNA-Gln
  145. Macaca mulatta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  146. Manacus vitellinus tRNA
  147. Manduca sexta (Tobacco hornworm) tRNA-Gln
  148. Marmota monax (woodchuck) tRNA.Gln
  149. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Gln
  150. Megalops atlanticus (tarpon) tRNA-Gln
  151. Meleagris gallopavo tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  152. Melipona bicolor tRNA-Gln
  153. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023534.1
  154. Merops nubicus tRNA
  155. Mesitornis unicolor tRNA
  156. Mesocricetus auratus tRNA
  157. Microcebus murinus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  158. Molorchus minor tRNA-Gln
  159. Monodelphis domestica tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  160. Monomorium pharaonis tRNA-Gln
  161. Musca domestica tRNA MDOA005923
  162. Mus caroli tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  163. Mus musculus castaneus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  164. Mus musculus domesticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  165. Mus musculus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  166. Mus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4, tRNA-Gln-CTG-3 1 to 4)
  167. Mus pahari tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  168. Mus spretus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  169. Mustela putorius furo tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  170. Myotis brandtii tRNA
  171. Myotis davidii tRNA
  172. Myotis lucifugus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  173. Mytilus galloprovincialis tRNA
  174. Nasonia vitripennis tRNA-Gln
  175. Neotoma lepida (desert woodrat) tRNA
  176. Nephila pilipes tRNA-Gln
  177. Nestor notabilis tRNA
  178. Nipponia nippon (crested ibis) tRNA
  179. Nomascus leucogenys tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  180. Notamacropus eugenii tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  181. Nothobranchius furzeri tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  182. Ochotona princeps tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  183. Ooceraea biroi tRNA-Gln
  184. Ophiophagus hannah tRNA
  185. Opisthocomus hoazin tRNA
  186. Oreochromis niloticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  187. Ornithorhynchus anatinus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  188. Orussus abietinus (Parasitic wood wasp) tRNA-Gln
  189. Oryctolagus cuniculus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  190. Oryzias latipes tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  191. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon CUG)
  192. Otolemur garnettii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  193. Ovis aries tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  194. Pangasianodon gigas (Mekong giant catfish) tRNA-Gln
  195. Pangasianodon hypophthalmus tRNA-Gln
  196. Pangasius djambal tRNA-Gln
  197. Pan troglodytes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  198. Papilio machaon tRNA
  199. Papilio xuthus tRNA
  200. Papio anubis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  201. Parasteatoda tepidariorum tRNA-Gln
  202. Patagioenas fasciata monilis tRNA
  203. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon CUG)
  204. Pelecanus crispus tRNA
  205. Pelobates cultripes tRNA.Gln
  206. Perca flavescens tRNA-Gln
  207. Perca fluviatilis (European perch) tRNA-Gln
  208. Phaethon lepturus tRNA
  209. Phalacrocorax carbo tRNA
  210. Phlebotomus papatasi (Sand fly) tRNA tRNA-Gln
  211. Phoenicopterus ruber ruber tRNA
  212. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  213. Dryobates pubescens tRNA
  214. Plutella xylostella (diamondback moth) tRNA-Gln
  215. Podarcis lilfordi tRNA.Gln
  216. Podiceps cristatus (great crested grebe) tRNA
  217. Poecilia formosa tRNA
  218. Pomacea canaliculata (Apple snail) tRNA-Gln
  219. Pongo abelii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  220. Potamilus streckersoni tRNA-Gln
  221. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  222. Pteropus alecto (black flying fox) tRNA
  223. Pygoscelis adeliae (Adelie penguin) tRNA
  224. Rattus norvegicus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2, tRNA-Gln-CTG-4-1)
  225. Rhagoletis pomonella tRNA-Gln
  226. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  227. Saimiri boliviensis boliviensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  228. Sarcophilus harrisii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  229. Scleropages formosus (Asian bonytongue) tRNA
  230. Sitophilus oryzae tRNA-Gln
  231. Solenopsis invicta tRNA
  232. Sorex araneus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  233. Sphaerodactylus townsendi tRNA-Gln
  234. Spodoptera frugiperda tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  235. Stegodyphus dumicola (Social spider) tRNA-Gln
  236. Stegodyphus mimosarum (African social velvet spider) tRNA-Gln for anticodon CUG
  237. Stomoxys calcitrans tRNA-Gln
  238. Struthio camelus australis tRNA
  239. Sus scrofa tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  240. Taeniopygia guttata tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  241. Takifugu rubripes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  242. Tetraodon nigroviridis tRNA
  243. Tinamus guttatus tRNA
  244. Trachymyrmex cornetzi tRNA
  245. Trachymyrmex septentrionalis tRNA
  246. Trachymyrmex zeteki tRNA
  247. Trichechus manatus latirostris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  248. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  249. Trichomalopsis sarcophagae tRNA
  250. Trichonephila clavata tRNA-Gln
  251. Trichonephila inaurata madagascariensis tRNA-Gln
  252. Tropilaelaps mercedesae tRNA
  253. Tupaia chinensis (Chinese tree shrew) tRNA
  254. Tursiops truncatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  255. Tyto alba tRNA
  256. Varroa destructor (Honeybee mite) tRNA-Gln
  257. Varroa jacobsoni (Varroa mite) tRNA-Gln
  258. Venturia canescens (Endoparasitoid wasp) tRNA-Gln
  259. Vicugna pacos tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  260. Xenopus laevis tRNA
  261. Xenopus tropicalis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 31)
  262. Xiphophorus maculatus tRNA
  263. Zerene cesonia (Southern Dogface) tRNA-Gln
2D structure Publications