Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA secondary structure diagram

Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA URS0000415026_118154

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUCUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 824 other species

  1. Acanthisitta chloris tRNA
  2. Acanthochromis polyacanthus tRNA
  3. Accipiter nisus (Eurasian sparrowhawk) tRNA
  4. Acinonyx jubatus (cheetah) tRNA
  5. Acipenser ruthenus (sterlet) tRNA
  6. Acrocephalus arundinaceus (great reed warbler) tRNA
  7. Acromyrmex charruanus tRNA
  8. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gln
  9. Acromyrmex heyeri tRNA
  10. Acropora millepora tRNA-Gln
  11. Acyrthosiphon pisum (Pea aphid) tRNA-Gln
  12. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon CUG)
  13. Aegithalos caudatus tRNA
  14. Aegotheles bennettii tRNA
  15. Ailuropoda melanoleuca tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alca torda tRNA
  19. Ceyx cyanopectus Alcedo cyanopecta tRNA
  20. Aleadryas rufinucha (rufous-naped whistler) tRNA
  21. Alectura lathami (australian brush-turkey) tRNA
  22. Alligator mississippiensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  23. Alligator sinensis (Chinese alligator) tRNA
  24. Alosa alosa (allis shad) tRNA-Gln
  25. Amazona aestiva tRNA
  26. Amazona collaria (yellow-billed parrot) tRNA
  27. Amazona guildingii tRNA
  28. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011386.1
  29. Ameca splendens tRNA-Gln
  30. Ameiurus melas tRNA
  31. Amphiprion ocellaris (clown anemonefish) tRNA
  32. Amphiprion percula tRNA
  33. Amyelois transitella tRNA-Gln
  34. Anabarilius grahami tRNA
  35. Anabas testudineus tRNA
  36. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  37. Anas platyrhynchos tRNA
  38. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon CUG)
  39. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon CUG)
  40. Anas zonorhyncha tRNA
  41. Anguilla anguilla tRNA
  42. Anhinga anhinga tRNA
  43. Anhinga rufa (African darter) tRNA
  44. Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  45. Anseranas semipalmata (magpie goose) tRNA
  46. Anser brachyrhynchus (pink-footed goose) tRNA
  47. Anser cygnoides (Chinese goose) tRNA
  48. Anthonomus grandis grandis (Boll weevil) transfer RNA glutamine (anticodon CUG)
  49. Anthoscopus minutus tRNA
  50. Aotus nancymaae (Ma's night monkey) tRNA
  51. Apaloderma vittatum tRNA
  52. Aphelocoma coerulescens (scrub jay) tRNA
  53. Aphis glycines (soybean aphid) tRNA
  54. Aphis gossypii (cotton aphid) tRNA
  55. Aptenodytes forsteri (emperor penguin) tRNA
  56. Aptenodytes patagonicus (king penguin) tRNA
  57. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  58. Apteryx owenii (little spotted kiwi) tRNA
  59. Aquila chrysaetos chrysaetos tRNA
  60. Aramus guarauna (limpkin) tRNA
  61. Araneus ventricosus tRNA
  62. Ardeotis kori tRNA
  63. Arenaria interpres (ruddy turnstone) tRNA
  64. Argiope bruennichi tRNA
  65. Asarcornis scutulata tRNA
  66. Astyanax mexicanus tRNA
  67. Ataeniobius toweri tRNA-Gln
  68. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005011523.1
  69. Athene cunicularia tRNA
  70. Atlantisia rogersi (inaccessible island rail) tRNA
  71. Atractosteus spatula (alligator gar) tRNA
  72. Atrichornis clamosus tRNA
  73. Atta cephalotes tRNA LOC105616954-4
  74. Atta colombica tRNA
  75. Austrofundulus limnaeus tRNA
  76. Aythya fuligula (tufted duck) tRNA
  77. Bactrocera dorsalis tRNA-Gln
  78. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  79. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon CUG)
  80. Bactrocera tryoni (Queensland fruitfly) tRNA-Gln
  81. Bagarius yarrelli (goonch) tRNA
  82. Balaeniceps rex (shoebill) tRNA
  83. Balaenoptera acutorostrata scammoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  84. Balaenoptera musculus (Blue whale) tRNA
  85. Balaenoptera physalus (Fin whale) tRNA
  86. Balearica regulorum gibbericeps tRNA
  87. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  88. Baryphthengus martii tRNA
  89. Betta splendens (Siamese fighting fish) tRNA
  90. Bicyclus anynana tRNA-Gln
  91. Biomphalaria glabrata tRNA tRNA-Gln
  92. Biomphalaria pfeifferi tRNA-Gln
  93. Bison bison bison (north american plains bison) tRNA
  94. Bombycilla garrulus tRNA
  95. Bombyx mandarina tRNA-Gln
  96. Bombyx mori tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  97. Bos grunniens (domestic yak) tRNA
  98. Bos mutus Bos grunniens mutus tRNA
  99. Bos indicus tRNA
  100. Bos indicus x Bos taurus (hybrid cattle) tRNA
  101. Bos taurus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  102. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  103. Brenthis ino (lesser marbled fritillary) tRNA
  104. Bubo bubo tRNA
  105. Bucco capensis (collared puffbird) tRNA
  106. Buceros rhinoceros silvestris tRNA
  107. Bucorvus abyssinicus tRNA
  108. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  109. Burhinus bistriatus tRNA
  110. Buteo japonicus tRNA
  111. Caerostris darwini tRNA-Gln
  112. Caerostris extrusa tRNA-Gln
  113. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  114. Alaudala cheleensis Calandrella cheleensis tRNA
  115. Calcarius ornatus tRNA
  116. Callaeas wilsoni (north island kokako) tRNA
  117. Callipepla squamata (scaled quail) tRNA
  118. Callithrix jacchus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  119. Callorhinchus milii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  120. Callorhinus ursinus (northern fur seal) tRNA
  121. Callosobruchus analis hypothetical protein
  122. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  123. Caloenas nicobarica tRNA
  124. Calonectris borealis (cory's shearwater) tRNA
  125. Calypte anna (Anna's hummingbird) tRNA
  126. Calyptomena viridis (green broadbill) tRNA
  127. Camarhynchus parvulus tRNA
  128. Camelus bactrianus (Bactrian camel) tRNA
  129. Camelus dromedarius (Arabian camel) tRNA
  130. Camelus ferus (Wild Bactrian camel) tRNA
  131. Campylorhamphus procurvoides tRNA
  132. Candidula unifasciata tRNA
  133. Canis lupus dingo (dingo) tRNA
  134. Canis lupus familiaris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  135. Capra hircus (goat) tRNA
  136. Antrostomus carolinensis tRNA
  137. Carassius auratus (goldfish) tRNA
  138. Cardinalis cardinalis tRNA
  139. Cariama cristata (red-legged seriema) tRNA
  140. Carlito syrichta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  141. Castor canadensis (American beaver) tRNA
  142. Catagonus wagneri (Chacoan peccary) tRNA
  143. Cathartes aura (turkey vulture) tRNA
  144. Catharus fuscescens tRNA
  145. Catharus ustulatus tRNA
  146. Cavia porcellus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  147. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  148. Cebus imitator (Panamanian white-faced capuchin) tRNA
  149. Centropus unirufus tRNA
  150. Cephalopterus ornatus (amazonian umbrellabird) tRNA
  151. Cephus cinctus (wheat stem sawfly) tRNA
  152. Cepphus grylle tRNA
  153. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gln
  154. Ceratotherium simum simum tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  155. Cercocebus atys (sooty mangabey) tRNA
  156. Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  157. Certhia brachydactyla tRNA
  158. Certhia familiaris tRNA
  159. Cervus elaphus hippelaphus tRNA
  160. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  161. Cettia cetti tRNA
  162. Chaetops frenatus (Rufous rock-jumper) tRNA
  163. Chaetorhynchus papuensis (pygmy drongo) tRNA
  164. Chaetura pelagica (chimney swift) tRNA
  165. Channa argus (snakehead) tRNA
  166. Chanos chanos (milkfish) tRNA
  167. Characodon lateralis tRNA-Gln
  168. Charadrius vociferus tRNA
  169. Chauna torquata (southern screamer) tRNA
  170. Chelonia mydas (green seaturtle) tRNA
  171. Chelydra serpentina (snapping turtle) tRNA
  172. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  173. Chinchilla lanigera tRNA
  174. Chionis minor (black-faced sheathbill) tRNA
  175. Chlamydotis macqueenii Chlamydotis undulata macqueenii tRNA
  176. Chlorocebus sabaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  177. Chloroceryle aenea tRNA
  178. Chloropsis cyanopogon tRNA
  179. Chloropsis hardwickii tRNA
  180. Choloepus hoffmanni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  181. Chordeiles acutipennis (lesser nighthawk) tRNA
  182. Chrysemys picta bellii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  183. Chrysochloris asiatica tRNA
  184. Chrysodeixis includens tRNA
  185. Chrysolophus pictus (golden pheasant) tRNA
  186. Chunga burmeisteri (black-legged seriema) tRNA
  187. Ciccaba nigrolineata tRNA
  188. Ciconia maguari tRNA
  189. Cinclus mexicanus tRNA
  190. Circaetus pectoralis tRNA
  191. Cisticola juncidis tRNA
  192. Clarias magur (asian catfish) tRNA
  193. Climacteris rufus Climacteris rufa (rufous treecreeper) tRNA
  194. Cnemophilus loriae (Loria's bird-of-paradise) tRNA
  195. Cochlearius cochlearius tRNA
  196. Colinus virginianus tRNA
  197. Colius striatus tRNA
  198. Collichthys lucidus tRNA
  199. Colobus angolensis palliatus tRNA
  200. Columba livia tRNA
  201. Columbina picui (picui ground-dove) tRNA
  202. Conger conger tRNA
  203. Copidosoma floridanum (Parasitoid wasp) tRNA-Gln
  204. Copsychus sechellarum tRNA
  205. Cordylochernes scorpioides tRNA-Gln
  206. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015377.1
  207. Corvus brachyrhynchos (American crow) tRNA
  208. Corvus moneduloides (new caledonian crow) tRNA
  209. Corythaeola cristata (great blue turaco) tRNA
  210. Corythaixoides concolor (grey go-away-bird) tRNA
  211. Cottoperca gobio tRNA
  212. Coturnix japonica (Japanese quail) tRNA
  213. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  214. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  215. Magallana gigas (Pacific oyster) tRNA-Gln for anticodon CUG
  216. Crassostrea virginica (Eastern oyster) tRNA-Gln
  217. Crenichthys baileyi tRNA-Gln
  218. Cricetulus griseus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  219. Crocodylus porosus (Australian saltwater crocodile) tRNA
  220. Crocuta crocuta (spotted hyena) tRNA
  221. Crotophaga sulcirostris (groove-billed ani) tRNA
  222. Crypturellus soui tRNA
  223. Crypturellus undulatus tRNA
  224. Ctenocephalides felis (Cat flea) tRNA-Gln
  225. Cuculus canorus tRNA
  226. Cyanistes caeruleus tRNA
  227. Cyclopterus lumpus tRNA
  228. Cylas formicarius (Sweet potato weevil) transfer RNA glutamine (anticodon CUG)
  229. Cynoglossus semilaevis (tongue sole) tRNA
  230. Cyphomyrmex costatus tRNA
  231. Cyprinodon variegatus tRNA
  232. Cyprinus carpio carpio tRNA
  233. Cyprinus carpio (common carp) tRNA
  234. Danaus chrysippus (African queen) tRNA
  235. Danaus plexippus plexippus tRNA
  236. Danionella cerebrum tRNA-Gln
  237. Danionella translucida tRNA
  238. Danio rerio tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 58)
  239. Daphoenositta chrysoptera (varied sittella) tRNA
  240. Dasyornis broadbenti (rufous bristle-bird) tRNA
  241. Dasypus novemcinctus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  242. Daubentonia madagascariensis tRNA-Gln
  243. Delphinapterus leucas (beluga whale) tRNA
  244. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  245. Denticeps clupeoides (denticle herring) tRNA
  246. Diatraea saccharalis (sugarcane borer) tRNA
  247. Dicaeum eximium tRNA
  248. Dicentrarchus labrax (European seabass) tRNA
  249. Diceros bicornis minor tRNA
  250. Dicrurus megarhynchus tRNA
  251. Dinoponera quadriceps (south american ant) tRNA
  252. Dipodomys ordii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  253. Dissostichus mawsoni tRNA
  254. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  255. Donacobius atricapilla tRNA
  256. Dromaius novaehollandiae (emu) tRNA
  257. Dromas ardeola tRNA
  258. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon CUG)
  259. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  260. Drosophila arizonae (Fruit fly) tRNA-Gln
  261. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  262. Drosophila bipectinata (Fruit fly) tRNA-Gln
  263. Drosophila busckii (Fruit fly) tRNA-Gln
  264. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  265. Drosophila eugracilis (Fruit fly) tRNA-Gln
  266. Drosophila ficusphila (Fruit fly) tRNA-Gln
  267. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  268. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  269. Drosophila hydei (Fruit fly) tRNA-Gln
  270. Drosophila innubila (Fruit fly) tRNA-Gln
  271. Drosophila kikkawai (Fruit fly) tRNA-Gln
  272. Drosophila mauritiana (Fruit fly) tRNA-Gln
  273. Drosophila melanogaster transfer RNA:Glutamine-CTG 1-1 (Dmel_CR30237)
  274. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  275. Drosophila navojoa (Fruit fly) tRNA-Gln
  276. Drosophila santomea (Fruit fly) tRNA-Gln
  277. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  278. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  279. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  280. Drosophila suzukii (Fruit fly) tRNA-Gln
  281. Drosophila takahashii (Fruit fly) tRNA-Gln
  282. Drosophila teissieri (Fruit fly) tRNA-Gln
  283. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  284. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  285. Drymodes brunneopygia tRNA
  286. Dryococelus australis tRNA-OTHER
  287. Dryoscopus gambensis tRNA
  288. Echeneis naucrates (live sharksucker) tRNA
  289. Echinops telfairi tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  290. Edolisoma coerulescens tRNA
  291. Egretta garzetta tRNA
  292. Elachura formosa (spotted wren-babbler) tRNA
  293. Electrophorus electricus (electric eel) tRNA
  294. Elysia chlorotica (eastern emerald elysia) tRNA
  295. Emberiza fucata tRNA
  296. Enhydra lutris kenyoni tRNA
  297. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  298. Eptatretus burgeri (inshore hagfish) tRNA
  299. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  300. Equus asinus (ass) tRNA
  301. Equus caballus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  302. Erinaceus europaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  303. Erithacus rubecula (European robin) tRNA
  304. Erpetoichthys calabaricus (reedfish) tRNA
  305. Erpornis zantholeuca tRNA
  306. Erythrocercus mccallii tRNA
  307. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  308. Etheostoma spectabile (orangethroat darter) tRNA
  309. Eubucco bourcierii (red-headed barbet) tRNA
  310. Eudromia elegans (elegant crested-tinamou) tRNA
  311. Eudyptes chrysocome (Rockhopper penguin) tRNA
  312. Eudyptula minor (little blue penguin) tRNA
  313. Eulacestoma nigropectus (wattled ploughbill) tRNA
  314. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  315. Eurypyga helias (sunbittern) tRNA
  316. Eurystomus gularis tRNA
  317. Exocentrus adspersus tRNA-Gln
  318. Falco tinnunculus (common kestrel) tRNA
  319. Falcunculus frontatus (crested shrike-tit) tRNA
  320. Felis catus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  321. Ficedula albicollis tRNA
  322. Formicarius rufipectus tRNA
  323. Fregata magnificens tRNA
  324. Fregetta grallaria tRNA
  325. Frieseomelitta varia tRNA
  326. Fukomys damarensis (Damara mole-rat) tRNA
  327. Fulmarus glacialis (northern fulmar) tRNA
  328. Furnarius figulus tRNA
  329. Galbula dea tRNA
  330. Galemys pyrenaicus tRNA
  331. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  332. Galleria mellonella tRNA-Gln
  333. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  334. Gallus gallus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  335. Gambusia affinis (western mosquitofish) tRNA
  336. Gasterosteus aculeatus (three-spined stickleback) tRNA
  337. Gavia stellata tRNA
  338. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  339. Geococcyx californianus tRNA
  340. Geospiza fortis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  341. Geotrypetes seraphini tRNA
  342. Glareola pratincola tRNA
  343. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  344. Glossina austeni tRNA tRNA-Gln
  345. Glossina brevipalpis tRNA tRNA-Gln
  346. Glossina fuscipes fuscipes tRNA
  347. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  348. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gln
  349. Glossina palpalis gambiensis tRNA tRNA-Gln
  350. Goodea atripinnis tRNA-Gln
  351. Gopherus agassizii (desert tortoise) tRNA
  352. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  353. Gorilla gorilla gorilla tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  354. Gouania willdenowi (blunt-snouted clingfish) tRNA
  355. Grallaria varia (variegated antpitta) tRNA
  356. Grantiella picta tRNA
  357. Grus americana (whooping crane) tRNA
  358. Gulo gulo (wolverine) tRNA
  359. Gymnodraco acuticeps tRNA
  360. Halcyon senegalensis tRNA
  361. Haliaeetus albicilla (white-tailed eagle) tRNA
  362. Haplochromis burtoni tRNA
  363. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  364. Heliconius melpomene (Postman butterfly) tRNA HMEL017634
  365. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon CUG)
  366. Helicoverpa zea (Corn earworm) tRNA-Gln
  367. Heliornis fulica (sungrebe) tRNA
  368. Heliothis virescens (tobacco budworm) tRNA
  369. Hemibagrus wyckioides tRNA
  370. Hemiprocne comata tRNA
  371. Henosepilachna vigintioctopunctata tRNA-Gln
  372. Herpetotheres cachinnans tRNA
  373. Heterocephalus glaber tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  374. Himantopus himantopus (black-winged stilt) tRNA
  375. Hippoglossus stenolepis tRNA-Gln
  376. Hippolais icterina (icterine warbler) tRNA
  377. Hipposideros armiger tRNA
  378. Hirundo rustica (Barn swallow) tRNA
  379. Hirundo rustica rustica tRNA
  380. Homalodisca vitripennis tRNA-Gln
  381. Homo sapiens tRNA-Gln (anticodon CTG) 1-1 (TRQ-CTG1 1 to 5)
  382. Horornis vulcanius tRNA
  383. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon CUG)
  384. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon CUG)
  385. Hylia prasina (green hylia) tRNA
  386. Hymenochirus boettgeri tRNA
  387. Hypocryptadius cinnamomeus tRNA
  388. Ibidorhyncha struthersii tRNA
  389. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005012187.1
  390. Ictidomys tridecemlineatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  391. Ifrita kowaldi (blue-capped ifrita) tRNA
  392. Ignelater luminosus (cucubano) tRNA
  393. Illadopsis cleaveri (blackcap illadopsis) tRNA
  394. Ilyodon furcidens tRNA-Gln
  395. Indicator maculatus tRNA
  396. Irena cyanogastra Irena cyanogaster tRNA
  397. Jacana jacana (wattled jacana) tRNA
  398. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  399. Junco hyemalis (dark-eyed junco) tRNA
  400. Kryptolebias marmoratus (mangrove rivulus) tRNA
  401. Labeo rohita (rohu) tRNA
  402. Labrus bergylta (ballan wrasse) tRNA
  403. Lamprotornis superbus tRNA
  404. Lanius ludovicianus tRNA
  405. Larimichthys crocea tRNA
  406. Larus smithsonianus tRNA
  407. Lates calcarifer (barramundi perch) tRNA
  408. Laticauda laticaudata (blue-ringed sea krait) tRNA
  409. Latimeria chalumnae tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  410. Leguminivora glycinivorella tRNA-Gln
  411. Leiothrix lutea (red-billed leiothrix) tRNA
  412. Lepidothrix coronata tRNA
  413. Lepisosteus oculatus (spotted gar) tRNA
  414. Leptidea sinapis tRNA
  415. Leptinotarsa decemlineata tRNA-Gln
  416. Leptobrachium leishanense (Leishan spiny toad) tRNA
  417. Leptocoma aspasia tRNA
  418. Leptonychotes weddellii (Weddell seal) tRNA
  419. Leptosomus discolor tRNA
  420. Leucopsar rothschildi tRNA
  421. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068927.1
  422. Limulus polyphemus tRNA-Gln
  423. Lingula anatina (Lamp shell) tRNA-Gln
  424. Lipotes vexillifer (Yangtze River dolphin) tRNA
  425. Helopsaltes ochotensis Locustella ochotensis tRNA
  426. Lonchura striata domestica (Bengalese finch) tRNA
  427. Lophotis ruficrista tRNA
  428. Loxia curvirostra tRNA
  429. Loxia leucoptera tRNA
  430. Loxodonta africana tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  431. Lucilia cuprina tRNA-Gln for anticodon CUG
  432. Lutzomyia longipalpis tRNA tRNA-Gln
  433. Lynx canadensis (Canada lynx) tRNA
  434. Lynx pardinus (Spanish lynx) tRNA
  435. Macaca fascicularis (crab-eating macaque) tRNA
  436. Macaca mulatta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  437. Macaca nemestrina (pig-tailed macaque) tRNA
  438. Machaerirhynchus nigripectus tRNA
  439. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011443.1
  440. Malurus cyaneus samueli tRNA
  441. Malurus elegans (Red-winged fairywren) tRNA
  442. Manacus vitellinus (golden-collared manakin) tRNA
  443. Mandrillus leucophaeus (drill) tRNA
  444. Manduca sexta tRNA-Gln
  445. Marmota marmota marmota (Alpine marmot) tRNA
  446. Marmota monax tRNA
  447. Mastacembelus armatus tRNA
  448. Mauremys mutica tRNA
  449. Maylandia zebra (zebra mbuna) tRNA
  450. Megachile rotundata tRNA-Gln
  451. Megalops atlanticus (tarpon) tRNA
  452. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  453. Melanocharis versteri (fan-tailed berrypecker) tRNA
  454. Meleagris gallopavo tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  455. Melipona bicolor tRNA
  456. Melitaea cinxia misc RNA ENSMCXG00005023534.1
  457. Melopsittacus undulatus (budgerigar) tRNA
  458. Melospiza melodia (song sparrow) tRNA
  459. Menidia menidia (Atlantic silverside) tRNA
  460. Menura novaehollandiae (superb lyrebird) tRNA
  461. Merluccius polli (Benguela hake) tRNA
  462. Merops nubicus tRNA
  463. Mesembrinibis cayennensis tRNA
  464. Mesitornis unicolor (brown roatelo) tRNA
  465. Mesocricetus auratus (golden hamster) tRNA
  466. Microcaecilia unicolor tRNA
  467. Microcebus murinus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  468. Microtus ochrogaster (prairie vole) tRNA
  469. Mimus melanotis tRNA-Gln
  470. Mionectes macconnelli (McConnell's flycatcher) tRNA
  471. Mohoua ochrocephala tRNA
  472. Mola mola (ocean sunfish) tRNA
  473. Molorchus minor tRNA-Gln
  474. Molossus molossus (Pallas's mastiff bat) tRNA
  475. Molothrus ater tRNA
  476. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  477. Monodelphis domestica tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  478. Monodon monoceros (narwhal) tRNA
  479. Monomorium pharaonis tRNA-Gln
  480. Moschus moschiferus (Siberian musk deer) tRNA
  481. Motacilla alba tRNA
  482. Muntiacus reevesi (Chinese muntjac) tRNA
  483. Musca domestica tRNA MDOA005923
  484. Mus caroli tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  485. Mus musculus castaneus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  486. Mus musculus domesticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  487. Mus musculus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  488. Mus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4, tRNA-Gln-CTG-3 1 to 4)
  489. Mus pahari tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  490. Mus spicilegus (steppe mouse) tRNA
  491. Mus spretus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  492. Mustela putorius furo tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  493. Myiagra hebetior tRNA
  494. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013047.1
  495. Myotis brandtii tRNA
  496. Myotis davidii tRNA
  497. Myotis lucifugus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  498. Myotis myotis tRNA
  499. Myripristis murdjan (pinecone soldierfish) tRNA
  500. Mystacornis crossleyi tRNA
  501. Mytilus californianus (California mussel) transfer RNA glutamine (anticodon CUG)
  502. Mytilus coruscus tRNA
  503. Mytilus edulis tRNA
  504. Mytilus galloprovincialis tRNA
  505. Naja naja tRNA
  506. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  507. Nasonia vitripennis tRNA-Gln
  508. Neodrepanis coruscans (wattled asity) tRNA
  509. Neogobius melanostomus (round goby) tRNA
  510. Neolamprologus brichardi tRNA
  511. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  512. Neopipo cinnamomea tRNA
  513. Neotoma lepida (desert woodrat) tRNA
  514. Neogale vison Neovison vison tRNA
  515. Nephila pilipes tRNA
  516. Nesidiocoris tenuis tRNA
  517. Nesospiza acunhae tRNA
  518. Nestor notabilis tRNA
  519. Nicator chloris tRNA
  520. Nipponia nippon (crested ibis) tRNA
  521. Nomascus leucogenys tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  522. Notamacropus eugenii tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  523. Notechis scutatus tRNA
  524. Nothobranchius furzeri tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  525. Nothocercus julius tRNA
  526. Nothoprocta ornata tRNA
  527. Nothoprocta perdicaria tRNA
  528. Notiomystis cincta tRNA
  529. Notothenia coriiceps (black rockcod) tRNA
  530. Nyctereutes procyonoides (raccoon dog) tRNA
  531. Nyctibius bracteatus tRNA
  532. Nyctibius grandis tRNA
  533. Nycticryphes semicollaris tRNA
  534. Nyctiprogne leucopyga tRNA
  535. Oceanites oceanicus tRNA
  536. Oceanodroma tethys tRNA
  537. Ochotona princeps tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  538. Octodon degus (degu) tRNA
  539. Odobenus rosmarus divergens (Pacific walrus) tRNA
  540. Odocoileus virginianus texanus tRNA
  541. Odontophorus gujanensis (marbled wood quail) tRNA
  542. Oenanthe oenanthe (Northern wheatear) tRNA
  543. Onychorhynchus coronatus tRNA
  544. Onychostoma macrolepis tRNA
  545. Ooceraea biroi tRNA-Gln
  546. Ophiophagus hannah tRNA
  547. Opisthocomus hoazin tRNA
  548. Oreocharis arfaki tRNA
  549. Oreochromis aureus tRNA
  550. Oreochromis niloticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  551. Oreotrochilus melanogaster tRNA
  552. Origma solitaria tRNA
  553. Oriolus oriolus tRNA
  554. Ornithorhynchus anatinus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  555. Orthonyx spaldingii (northern chowchilla) tRNA
  556. Orussus abietinus (Parasitic wood wasp) tRNA-Gln
  557. Orycteropus afer afer tRNA
  558. Oryctolagus cuniculus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  559. Oryzias javanicus tRNA
  560. Oryzias latipes tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  561. Oryzias melastigma (Indian medaka) tRNA
  562. Oryzias sinensis tRNA
  563. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon CUG)
  564. Otolemur garnettii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  565. Otus sunia (Oriental scops-owl) tRNA
  566. Ovis aries tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  567. Oxyruncus cristatus (sharpbill) tRNA
  568. Pachycephala philippinensis tRNA
  569. Pachyramphus minor tRNA
  570. Pandion haliaetus tRNA
  571. Pangasianodon gigas tRNA-Gln
  572. Pangasianodon hypophthalmus tRNA
  573. Pangasius djambal tRNA-Gln
  574. Pan paniscus (pygmy chimpanzee) tRNA
  575. Panthera leo (lion) tRNA
  576. Panthera tigris altaica (Amur tiger) tRNA
  577. Pantherophis guttatus tRNA
  578. Pan troglodytes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  579. Panurus biarmicus tRNA
  580. Papilio machaon tRNA
  581. Papilio xuthus tRNA
  582. Papio anubis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  583. Sinosuthora webbiana Paradoxornis webbianus tRNA
  584. Arctia plantaginis Parasemia plantaginis tRNA
  585. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  586. Pardalotus punctatus (spotted pardalote) tRNA
  587. Parnassius apollo (apollo) tRNA
  588. Passerina amoena tRNA
  589. Patagioenas fasciata monilis tRNA
  590. Pavo cristatus (Indian peafowl) tRNA
  591. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon CUG)
  592. Pelecanoides urinatrix tRNA
  593. Pelecanus crispus tRNA
  594. Pelobates cultripes tRNA.Gln
  595. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  596. Pelusios castaneus tRNA
  597. Penelope pileata tRNA
  598. Perca flavescens tRNA
  599. Perca fluviatilis tRNA
  600. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  601. Peucedramus taeniatus (olive warbler) tRNA
  602. Phaethon lepturus tRNA
  603. Phaetusa simplex (large-billed tern) tRNA
  604. Phainopepla nitens tRNA
  605. Phalacrocorax carbo (great cormorant) tRNA
  606. Phascolarctos cinereus (koala) tRNA
  607. Phasianus colchicus (Ring-necked pheasant) tRNA
  608. Pheucticus melanocephalus tRNA
  609. Phlebotomus argentipes (Sand fly) transfer RNA glutamine (anticodon CUG)
  610. Phlebotomus papatasi tRNA tRNA-Gln
  611. Phocoena sinus (vaquita) tRNA
  612. Phoenicopterus ruber ruber tRNA
  613. Photinus pyralis (common eastern firefly) tRNA
  614. Phrynocephalus forsythii tRNA
  615. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  616. Phyllostomus discolor (pale spear-nosed bat) tRNA
  617. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  618. Piaya cayana (squirrel cuckoo) tRNA
  619. Picathartes gymnocephalus tRNA
  620. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  621. Pieris brassicae (large cabbage white) tRNA
  622. Pieris macdunnoughi tRNA
  623. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  624. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  625. Pipra filicauda tRNA
  626. Piprites chloris (white-winged piprites) tRNA
  627. Pitta sordida (hooded pitta) tRNA
  628. Platysteira castanea tRNA
  629. Platysternon megacephalum (big-headed turtle) tRNA
  630. Plecturocebus cupreus tRNA-OTHER
  631. Ploceus nigricollis tRNA
  632. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon CUG)
  633. Plutella xylostella (diamondback moth) tRNA
  634. Pluvianellus socialis (magellanic plover) tRNA
  635. Podarcis lilfordi tRNA
  636. Podarcis muralis tRNA
  637. Podargus strigoides (tawny frogmouth) tRNA
  638. Podiceps cristatus (great crested grebe) tRNA
  639. Podilymbus podiceps tRNA
  640. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  641. Poecilia formosa tRNA
  642. Poecilia reticulata (guppy) tRNA
  643. Pogona vitticeps (central bearded dragon) tRNA
  644. Polioptila caerulea tRNA
  645. Polypterus senegalus tRNA
  646. Pomacea canaliculata tRNA-Gln
  647. Pomatorhinus ruficollis tRNA
  648. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  649. Pongo abelii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  650. Potamilus streckersoni tRNA-Gln
  651. Probosciger aterrimus tRNA
  652. Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  653. Prolemur simus (greater bamboo lemur) tRNA
  654. Promerops cafer (Cape sugarbird) tRNA
  655. Propithecus coquereli (Coquerel's sifaka) tRNA
  656. Prunella fulvescens tRNA
  657. Prunella himalayana tRNA
  658. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  659. Pseudoatta argentina tRNA
  660. Pseudomonas sp. PHC1 tRNA-Gln
  661. Pseudonaja textilis tRNA
  662. Psilopogon haemacephalus tRNA
  663. Psophia crepitans (common trumpeter) tRNA
  664. Pterocles burchelli tRNA
  665. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  666. Pteropus alecto (black flying fox) tRNA
  667. Pteropus vampyrus (large flying fox) tRNA
  668. Pteruthius melanotis tRNA
  669. Ptilonorhynchus violaceus (satin bowerbird) tRNA
  670. Ptilorrhoa leucosticta tRNA
  671. Puma concolor (puma) tRNA
  672. Pundamilia nyererei tRNA
  673. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  674. Pycnonotus jocosus tRNA
  675. Pygoscelis adeliae (Adelie penguin) tRNA
  676. Pygoscelis papua tRNA
  677. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  678. Quiscalus mexicanus tRNA
  679. Ramphastos sulfuratus tRNA
  680. Aquarana catesbeiana Rana catesbeiana (bullfrog) tRNA
  681. Rattus norvegicus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2, tRNA-Gln-CTG-4-1)
  682. Regulus satrapa (golden-crowned kinglet) tRNA
  683. Rhabdornis inornatus tRNA
  684. Rhadina sibilatrix tRNA
  685. Rhagoletis pomonella tRNA-Gln
  686. Rhagologus leucostigma tRNA
  687. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  688. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  689. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  690. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  691. Rhipidura dahli tRNA
  692. Rhodinocichla rosea tRNA
  693. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  694. Rhynchophorus ferrugineus (red palm weevil) tRNA
  695. Rhynochetos jubatus (kagu) tRNA
  696. Rissa tridactyla (black-legged kittiwake) tRNA
  697. Rostratula benghalensis (greater painted-snipe) tRNA
  698. Rousettus aegyptiacus (Egyptian rousette) tRNA
  699. Rynchops niger (black skimmer) tRNA
  700. Sagittarius serpentarius tRNA
  701. Saimiri boliviensis boliviensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  702. Sakesphorus luctuosus tRNA
  703. Salarias fasciatus (jewelled blenny) tRNA
  704. Sander lucioperca (pike-perch) tRNA
  705. Sapayoa aenigma (broad-billed sapayoa) tRNA
  706. Sarcophilus harrisii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  707. Sciurus carolinensis (gray squirrel) tRNA
  708. Sciurus vulgaris (Eurasian red squirrel) tRNA
  709. Scleropages formosus tRNA
  710. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  711. Scophthalmus maximus (turbot) tRNA
  712. Scopus umbretta (hamerkop) tRNA
  713. Scyliorhinus torazame (cloudy catshark) tRNA
  714. Scytalopus superciliaris tRNA
  715. Semnornis frantzii tRNA
  716. Serilophus lunatus (silver-breasted broadbill) tRNA
  717. Serinus canaria (common canary) tRNA
  718. Sigmodon hispidus tRNA-Gln
  719. Silurus meridionalis tRNA
  720. Sinocyclocheilus anshuiensis tRNA
  721. Sinocyclocheilus grahami tRNA
  722. Sinocyclocheilus rhinocerous tRNA
  723. Sitophilus oryzae (Rice weevil) tRNA-Gln
  724. Sitta europaea (wood nuthatch) tRNA
  725. Smithornis capensis tRNA
  726. Solenopsis invicta (red fire ant) tRNA
  727. Sorex araneus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  728. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  729. Sparus aurata (gilthead seabream) tRNA
  730. Spermophilus dauricus (Daurian ground squirrel) tRNA
  731. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  732. Sphaeramia orbicularis tRNA
  733. Sphaerodactylus townsendi tRNA-Gln
  734. Sphenodon punctatus (tuatara) tRNA
  735. Spizaetus tyrannus (black hawk-eagle) tRNA
  736. Spizella passerina (chipping sparrow) tRNA
  737. Spodoptera exigua (beet armyworm) tRNA
  738. Spodoptera frugiperda tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  739. Spodoptera littoralis tRNA
  740. Spodoptera litura tRNA
  741. Steatornis caripensis (oilbird) tRNA
  742. Stegastes partitus (bicolor damselfish) tRNA
  743. Stegodyphus dumicola (Social spider) tRNA-Gln
  744. Stegodyphus mimosarum tRNA-Gln for anticodon CUG
  745. Stercorarius parasiticus tRNA
  746. Sterrhoptilus dennistouni tRNA
  747. Stomoxys calcitrans tRNA-Gln
  748. Strigops habroptila (kakapo) tRNA
  749. Strix occidentalis caurina tRNA
  750. Struthidea cinerea tRNA
  751. Struthio camelus australis tRNA
  752. Sula dactylatra tRNA
  753. Suricata suricatta (meerkat) tRNA
  754. Sus scrofa tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  755. Sylvia atricapilla (blackcap) tRNA
  756. Sylvia borin tRNA
  757. Sylvietta virens (green crombec) tRNA
  758. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  759. Tachuris rubrigastra tRNA
  760. Taeniopygia guttata tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  761. Takifugu bimaculatus tRNA
  762. Takifugu flavidus tRNA
  763. Takifugu rubripes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  764. Temnothorax curvispinosus tRNA
  765. Temnothorax longispinosus tRNA
  766. Tenebrio molitor (yellow mealworm) tRNA
  767. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  768. Tetraodon nigroviridis tRNA
  769. Thalassarche chlororhynchos tRNA
  770. Thamnophis sirtalis tRNA
  771. Theropithecus gelada (gelada baboon) tRNA
  772. Thinocorus orbignyianus tRNA
  773. Thryothorus ludovicianus tRNA
  774. Tichodroma muraria tRNA
  775. Tinamus guttatus tRNA
  776. Todus mexicanus (puerto rican tody) tRNA
  777. Toxostoma redivivum tRNA
  778. Trachymyrmex cornetzi tRNA
  779. Trachymyrmex septentrionalis tRNA
  780. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  781. Trichechus manatus latirostris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  782. Trichogramma brassicae tRNA
  783. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  784. Tricholaema leucomelas (pied barbet) tRNA
  785. Trichomalopsis sarcophagae tRNA
  786. Trichonephila clavata (joro spider) tRNA
  787. Trichonephila clavipes (golden silk orbweaver) tRNA
  788. Trichonephila inaurata madagascariensis tRNA
  789. Trichoplusia ni (cabbage looper) tRNA
  790. Triplophysa rosa (cave loach) tRNA
  791. Triplophysa tibetana tRNA
  792. Trogon melanurus (black-tailed trogon) tRNA
  793. Tropilaelaps mercedesae tRNA
  794. Tupaia chinensis (Chinese tree shrew) tRNA
  795. Salvator merianae Tupinambis merianae tRNA
  796. Turnix velox (little buttonquail) tRNA
  797. Tursiops truncatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  798. Tyrannus savana (fork-tailed flycatcher) tRNA
  799. Tyto alba tRNA
  800. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon CUG)
  801. Upupa epops (Eurasian hoopoe) tRNA
  802. Urocolius indicus tRNA
  803. Urocynchramus pylzowi tRNA
  804. Ursus americanus (American black bear) tRNA
  805. Ursus maritimus (polar bear) tRNA
  806. Vanessa tameamea tRNA
  807. Varanus komodoensis tRNA
  808. Varroa destructor (Honeybee mite) tRNA-Gln
  809. Varroa jacobsoni (Varroa mite) tRNA-Gln
  810. Venturia canescens (Endoparasitoid wasp) tRNA-Gln
  811. Vicugna pacos tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  812. Vidua chalybeata tRNA
  813. Vidua macroura tRNA
  814. Vireo altiloquus (black-whiskered vireo) tRNA
  815. Vombatus ursinus (common wombat) tRNA
  816. Vulpes vulpes (red fox) tRNA
  817. Xenoophorus captivus tRNA-Gln
  818. Xenopus laevis (African clawed frog) tRNA
  819. Xenopus tropicalis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 31)
  820. Xenotaenia resolanae tRNA-Gln
  821. Xiphophorus maculatus (southern platyfish) tRNA
  822. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  823. Zapornia atra tRNA
  824. Zerene cesonia (Southern Dogface) tRNA-Gln
  825. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon CUG)
  826. Zonotrichia albicollis tRNA
  827. Zophobas morio tRNA
  828. Zosterops borbonicus tRNA
  829. Zosterops hypoxanthus tRNA
  830. Zosterops lateralis melanops tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...