Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cathartes aura (turkey vulture) tRNA secondary structure diagram

Cathartes aura (turkey vulture) tRNA URS0000415026_43455

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUCUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 263 other species

  1. Acanthisitta chloris tRNA
  2. Acromyrmex echinatior tRNA-Gln
  3. Acropora millepora (Stony coral) tRNA-Gln
  4. Acyrthosiphon pisum tRNA-Gln
  5. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon CUG)
  6. Ailuropoda melanoleuca tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  7. Albula glossodonta tRNA-OTHER
  8. Albula goreensis tRNA-Gln
  9. Alligator mississippiensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  10. Alosa alosa tRNA-Gln
  11. Amazona aestiva tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011386.1
  13. Ameiurus melas tRNA-Gln
  14. Amyelois transitella (Naval orange worm) tRNA-Gln
  15. Anas platyrhynchos tRNA
  16. Anguilla anguilla (European eel) tRNA-Gln
  17. Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  18. Anthonomus grandis grandis transfer RNA glutamine (anticodon CUG)
  19. Apaloderma vittatum tRNA
  20. Aptenodytes forsteri tRNA
  21. Astyanax mexicanus tRNA
  22. Ataeniobius toweri tRNA-Gln
  23. Athalia rosae misc RNA ENSAEAG00005011523.1
  24. Atta cephalotes tRNA LOC105616954-4
  25. Atta colombica tRNA
  26. Bactrocera dorsalis (Oriental fruit fly) tRNA-Gln
  27. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  28. Bactrocera tryoni tRNA-Gln
  29. Balaenoptera acutorostrata scammoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  30. Balearica regulorum gibbericeps tRNA
  31. Bicyclus anynana (Squinting bush brown) tRNA-Gln
  32. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Gln
  33. Biomphalaria pfeifferi tRNA-Gln
  34. Bombyx mandarina (Wild silkworm) tRNA-Gln
  35. Bombyx mori tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  36. Bos taurus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  37. Buceros rhinoceros silvestris tRNA
  38. Caerostris darwini tRNA-Gln
  39. Caerostris extrusa tRNA-Gln
  40. Callipepla squamata tRNA
  41. Callithrix jacchus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  42. Callorhinchus milii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  43. Callosobruchus analis hypothetical protein
  44. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  45. Calypte anna tRNA
  46. Camelus ferus tRNA
  47. Canis lupus familiaris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  48. Antrostomus carolinensis tRNA
  49. Cariama cristata tRNA
  50. Carlito syrichta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  51. Cavia porcellus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  52. Ceratitis capitata (Mediterranean fruit fly) tRNA-Gln
  53. Ceratotherium simum simum tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  54. Chaetura pelagica (chimney swift) tRNA
  55. Characodon lateralis tRNA-Gln
  56. Charadrius vociferus tRNA
  57. Chelonia mydas (green seaturtle) tRNA
  58. Chelydra serpentina tRNA-Gln
  59. Chlamydotis macqueenii tRNA
  60. Chlorocebus sabaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  61. Choloepus hoffmanni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  62. Chrysemys picta bellii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  63. Colinus virginianus tRNA
  64. Colius striatus (speckled mousebird) tRNA
  65. Columba livia tRNA
  66. Copidosoma floridanum tRNA-Gln
  67. Cordylochernes scorpioides tRNA-Gln
  68. Corvus brachyrhynchos (American crow) tRNA
  69. Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  70. Crassostrea gigas tRNA-Gln for anticodon CUG
  71. Crassostrea virginica tRNA-Gln
  72. Crenichthys baileyi tRNA-Gln
  73. Cricetulus griseus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  74. Cuculus canorus tRNA
  75. Cyphomyrmex costatus tRNA
  76. Danaus plexippus plexippus tRNA
  77. Danionella translucida tRNA-Gln
  78. Danio rerio tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 58)
  79. Dasypus novemcinctus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  80. Dipodomys ordii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  81. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  82. Drosophila busckii tRNA
  83. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  84. Drosophila ficusphila tRNA
  85. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  86. Drosophila gunungcola tRNA-OTHER
  87. Drosophila melanogaster transfer RNA:Glutamine-CTG 1-1 (Dmel_CR30237)
  88. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  89. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  90. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  91. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  92. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  93. Dryococelus australis tRNA-OTHER
  94. Echinops telfairi tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  95. Egretta garzetta tRNA
  96. Eptesicus nilssonii tRNA-Gln
  97. Equus caballus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  98. Erinaceus europaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  99. Eurypyga helias (sunbittern) tRNA
  100. Exocentrus adspersus tRNA-Gln
  101. Felis catus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  102. Ficedula albicollis tRNA
  103. Frieseomelitta varia tRNA-Gln
  104. Fukomys damarensis tRNA
  105. Fulmarus glacialis tRNA
  106. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  107. Galleria mellonella (Greater wax moth) tRNA-Gln
  108. Gallus gallus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  109. Gasterosteus aculeatus tRNA
  110. Gavia stellata tRNA
  111. Geospiza fortis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  112. Glossina austeni tRNA tRNA-Gln
  113. Glossina brevipalpis tRNA tRNA-Gln
  114. Glossina fuscipes fuscipes tRNA
  115. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  116. Glossina pallidipes tRNA tRNA-Gln
  117. Glossina palpalis gambiensis tRNA tRNA-Gln
  118. Gorilla gorilla gorilla tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  119. Haliaeetus albicilla (white-tailed eagle) tRNA
  120. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  121. Heliconius melpomene (Postman butterfly) tRNA HMEL017634
  122. Helicoverpa armigera transfer RNA glutamine (anticodon CUG)
  123. Helicoverpa zea (Corn earworm) tRNA-Gln
  124. Heterocephalus glaber tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  125. Hippoglossus stenolepis (Pacific halibut) tRNA-Gln
  126. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  127. Homo sapiens tRNA-Gln (anticodon CTG) 1-1 (TRQ-CTG1 1 to 5)
  128. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005012187.1
  129. Ictidomys tridecemlineatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  130. Lamprotornis superbus tRNA-OTHER
  131. Larimichthys crocea tRNA
  132. Latimeria chalumnae tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  133. Leguminivora glycinivorella (Soybean pod borer) tRNA-Gln
  134. Lepisosteus oculatus (spotted gar) tRNA
  135. Leptinotarsa decemlineata tRNA-Gln
  136. Leptosomus discolor tRNA
  137. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000068927.1
  138. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln
  139. Lingula anatina (Lamp shell) tRNA-Gln
  140. Lonchura striata domestica (Bengalese finch) tRNA
  141. Loxodonta africana tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  142. Lucilia cuprina (Australian sheep blowfly) tRNA-Gln for anticodon CUG
  143. Lutzomyia longipalpis tRNA tRNA-Gln
  144. Macaca mulatta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  145. Manacus vitellinus tRNA
  146. Manduca sexta (Tobacco hornworm) tRNA-Gln
  147. Marmota monax (woodchuck) tRNA.Gln
  148. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Gln
  149. Megalops atlanticus (tarpon) tRNA-Gln
  150. Meleagris gallopavo tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  151. Melipona bicolor tRNA-Gln
  152. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023534.1
  153. Merops nubicus tRNA
  154. Mesitornis unicolor tRNA
  155. Mesocricetus auratus tRNA
  156. Microcebus murinus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  157. Molorchus minor tRNA-Gln
  158. Monodelphis domestica tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  159. Monomorium pharaonis tRNA-Gln
  160. Musca domestica tRNA MDOA005923
  161. Mus caroli tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  162. Mus musculus castaneus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  163. Mus musculus domesticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  164. Mus musculus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  165. Mus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4, tRNA-Gln-CTG-3 1 to 4)
  166. Mus pahari tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  167. Mus spretus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  168. Mustela putorius furo tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  169. Myotis brandtii tRNA
  170. Myotis davidii tRNA
  171. Myotis lucifugus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  172. Mytilus galloprovincialis tRNA
  173. Nasonia vitripennis tRNA-Gln
  174. Neotoma lepida (desert woodrat) tRNA
  175. Nephila pilipes tRNA-Gln
  176. Nestor notabilis tRNA
  177. Nipponia nippon (crested ibis) tRNA
  178. Nomascus leucogenys tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  179. Notamacropus eugenii tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  180. Nothobranchius furzeri tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  181. Ochotona princeps tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  182. Ooceraea biroi tRNA-Gln
  183. Ophiophagus hannah tRNA
  184. Opisthocomus hoazin tRNA
  185. Oreochromis niloticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  186. Ornithorhynchus anatinus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  187. Orussus abietinus (Parasitic wood wasp) tRNA-Gln
  188. Oryctolagus cuniculus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  189. Oryzias latipes tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  190. Ostrea edulis (European flat oyster) transfer RNA glutamine (anticodon CUG)
  191. Otolemur garnettii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  192. Ovis aries tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  193. Pangasianodon gigas (Mekong giant catfish) tRNA-Gln
  194. Pangasianodon hypophthalmus tRNA-Gln
  195. Pangasius djambal tRNA-Gln
  196. Pan troglodytes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  197. Papilio machaon tRNA
  198. Papilio xuthus tRNA
  199. Papio anubis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  200. Parasteatoda tepidariorum tRNA-Gln
  201. Patagioenas fasciata monilis tRNA
  202. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon CUG)
  203. Pelecanus crispus tRNA
  204. Pelobates cultripes tRNA.Gln
  205. Perca flavescens tRNA-Gln
  206. Perca fluviatilis (European perch) tRNA-Gln
  207. Phaethon lepturus tRNA
  208. Phalacrocorax carbo tRNA
  209. Phlebotomus papatasi (Sand fly) tRNA tRNA-Gln
  210. Phoenicopterus ruber ruber tRNA
  211. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  212. Dryobates pubescens tRNA
  213. Plutella xylostella (diamondback moth) tRNA-Gln
  214. Podarcis lilfordi tRNA.Gln
  215. Podiceps cristatus (great crested grebe) tRNA
  216. Poecilia formosa tRNA
  217. Pomacea canaliculata (Apple snail) tRNA-Gln
  218. Pongo abelii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  219. Potamilus streckersoni tRNA-Gln
  220. Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  221. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  222. Pteropus alecto (black flying fox) tRNA
  223. Pygoscelis adeliae (Adelie penguin) tRNA
  224. Rattus norvegicus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2, tRNA-Gln-CTG-4-1)
  225. Rhagoletis pomonella tRNA-Gln
  226. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  227. Saimiri boliviensis boliviensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  228. Sarcophilus harrisii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  229. Scleropages formosus (Asian bonytongue) tRNA
  230. Sitophilus oryzae tRNA-Gln
  231. Solenopsis invicta tRNA
  232. Sorex araneus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  233. Sphaerodactylus townsendi tRNA-Gln
  234. Spodoptera frugiperda tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  235. Stegodyphus dumicola (Social spider) tRNA-Gln
  236. Stegodyphus mimosarum (African social velvet spider) tRNA-Gln for anticodon CUG
  237. Stomoxys calcitrans tRNA-Gln
  238. Struthio camelus australis tRNA
  239. Sus scrofa tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  240. Taeniopygia guttata tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  241. Takifugu rubripes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  242. Tetraodon nigroviridis tRNA
  243. Tinamus guttatus tRNA
  244. Trachymyrmex cornetzi tRNA
  245. Trachymyrmex septentrionalis tRNA
  246. Trachymyrmex zeteki tRNA
  247. Trichechus manatus latirostris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  248. Trichogramma pretiosum (Parasitoid wasp) tRNA-Gln
  249. Trichomalopsis sarcophagae tRNA
  250. Trichonephila clavata tRNA-Gln
  251. Trichonephila inaurata madagascariensis tRNA-Gln
  252. Tropilaelaps mercedesae tRNA
  253. Tupaia chinensis (Chinese tree shrew) tRNA
  254. Tursiops truncatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  255. Tyto alba tRNA
  256. Varroa destructor (Honeybee mite) tRNA-Gln
  257. Varroa jacobsoni (Varroa mite) tRNA-Gln
  258. Venturia canescens (Endoparasitoid wasp) tRNA-Gln
  259. Vicugna pacos tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  260. Xenopus laevis tRNA
  261. Xenopus tropicalis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 31)
  262. Xiphophorus maculatus tRNA
  263. Zerene cesonia (Southern Dogface) tRNA-Gln
2D structure Publications