Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callosobruchus chinensis (azuki bean weevil) hypothetical protein URS0000415026_146774

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUCUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Acanthisitta chloris tRNA
  2. Acanthochromis polyacanthus tRNA
  3. Accipiter nisus (Eurasian sparrowhawk) tRNA
  4. Acinonyx jubatus (cheetah) tRNA
  5. Acipenser ruthenus (sterlet) tRNA
  6. Acrocephalus arundinaceus (great reed warbler) tRNA
  7. Acromyrmex charruanus tRNA
  8. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Gln
  9. Acromyrmex heyeri tRNA
  10. Acropora millepora (Stony coral) tRNA-Gln
  11. Acyrthosiphon pisum tRNA-Gln
  12. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon CUG)
  13. Aegithalos caudatus tRNA
  14. Aegotheles bennettii tRNA
  15. Ailuropoda melanoleuca tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  16. Albula glossodonta (roundjaw bonefish) tRNA
  17. Albula goreensis tRNA
  18. Alca torda tRNA
  19. Ceyx cyanopectus Alcedo cyanopecta tRNA
  20. Aleadryas rufinucha (rufous-naped whistler) tRNA
  21. Alectura lathami (australian brush-turkey) tRNA
  22. Alligator mississippiensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  23. Alligator sinensis (Chinese alligator) tRNA
  24. Alosa alosa (allis shad) tRNA-Gln
  25. Amazona aestiva tRNA
  26. Amazona collaria (yellow-billed parrot) tRNA
  27. Amazona guildingii tRNA
  28. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011386.1
  29. Ameca splendens tRNA-Gln
  30. Ameiurus melas tRNA
  31. Amphiprion ocellaris (clown anemonefish) tRNA
  32. Amphiprion percula tRNA
  33. Amyelois transitella (Moths) transfer RNA glutamine (anticodon CUG)
  34. Anabarilius grahami tRNA
  35. Anabas testudineus tRNA
  36. Anas platyrhynchos platyrhynchos (common mallard) tRNA
  37. Anas platyrhynchos tRNA
  38. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamine (anticodon CUG)
  39. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamine (anticodon CUG)
  40. Anas zonorhyncha tRNA
  41. Anguilla anguilla (European eel) tRNA
  42. Anhinga anhinga tRNA
  43. Anhinga rufa (African darter) tRNA
  44. Anniella stebbinsi tRNA-Gln
  45. Anolis carolinensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  46. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Gln
  47. Anseranas semipalmata (magpie goose) tRNA
  48. Anser brachyrhynchus (pink-footed goose) tRNA
  49. Anser cygnoides (Chinese goose) tRNA
  50. Anthonomus grandis grandis transfer RNA glutamine (anticodon CUG)
  51. Anthoscopus minutus tRNA
  52. Aotus nancymaae (Ma's night monkey) tRNA
  53. Apaloderma vittatum tRNA
  54. Aphelocoma coerulescens (scrub jay) tRNA
  55. Aphis glycines (soybean aphid) tRNA
  56. Aphis gossypii (cotton aphid) tRNA
  57. Aptenodytes forsteri (emperor penguin) tRNA
  58. Aptenodytes patagonicus (king penguin) tRNA
  59. Apteryx mantelli mantelli Apteryx australis mantelli tRNA
  60. Apteryx owenii (little spotted kiwi) tRNA
  61. Aquila chrysaetos chrysaetos tRNA
  62. Aramus guarauna (limpkin) tRNA
  63. Araneus ventricosus tRNA
  64. Ardeotis kori tRNA
  65. Arenaria interpres (ruddy turnstone) tRNA
  66. Argiope bruennichi (Wasp spider) transfer RNA glutamine (anticodon CUG)
  67. Asarcornis scutulata tRNA
  68. Astyanax mexicanus (Mexican tetra) tRNA
  69. Ataeniobius toweri tRNA-Gln
  70. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005011523.1
  71. Athene cunicularia tRNA
  72. Atlantisia rogersi (inaccessible island rail) tRNA
  73. Atractosteus spatula (alligator gar) tRNA
  74. Atrichornis clamosus tRNA
  75. Atta cephalotes (Leaf-cutter ant) tRNA LOC105616954-4
  76. Atta colombica tRNA
  77. Austrofundulus limnaeus tRNA
  78. Aythya fuligula (tufted duck) tRNA
  79. Bactrocera dorsalis (Oriental fruit fly) transfer RNA glutamine (anticodon CUG)
  80. Bactrocera latifrons (Solanum fruit fly) tRNA-Gln
  81. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamine (anticodon CUG)
  82. Bactrocera oleae (Olive fruit fly) tRNA-Gln
  83. Bactrocera tryoni tRNA-Gln
  84. Bagarius yarrelli (goonch) tRNA
  85. Balaeniceps rex (shoebill) tRNA
  86. Balaenoptera acutorostrata scammoni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  87. Balaenoptera musculus (Blue whale) tRNA
  88. Balaenoptera physalus (Fin whale) tRNA
  89. Balearica regulorum gibbericeps tRNA
  90. Bambusicola thoracicus Bambusicola thoracica (Chinese bamboo-partridge) tRNA
  91. Baryphthengus martii tRNA
  92. Betta splendens (Siamese fighting fish) tRNA
  93. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026492.1
  94. Biomphalaria glabrata tRNA
  95. Biomphalaria pfeifferi tRNA-Gln
  96. Bison bison bison (north american plains bison) tRNA
  97. Bombycilla garrulus tRNA
  98. Bombyx mandarina tRNA-Gln
  99. Bombyx mori tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  100. Bos grunniens (domestic yak) tRNA
  101. Bos mutus Bos grunniens mutus tRNA
  102. Bos indicus tRNA
  103. Bos indicus x Bos taurus (hybrid cattle) tRNA
  104. Bos taurus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  105. Brachypteracias leptosomus (short-legged ground-roller) tRNA
  106. Brenthis ino (lesser marbled fritillary) tRNA
  107. Bubo bubo tRNA
  108. Bucco capensis (collared puffbird) tRNA
  109. Buceros rhinoceros silvestris tRNA
  110. Bucorvus abyssinicus tRNA
  111. Buphagus erythrorhynchus (red-billed oxpecker) tRNA
  112. Burhinus bistriatus tRNA
  113. Buteo japonicus tRNA
  114. Caerostris darwini tRNA-Gln
  115. Caerostris extrusa tRNA-Gln
  116. Cairina moschata domestica (muscovy duck (domestic type)) tRNA
  117. Alaudala cheleensis Calandrella cheleensis tRNA
  118. Calcarius ornatus tRNA
  119. Callaeas wilsoni (north island kokako) tRNA
  120. Callipepla squamata (scaled quail) tRNA
  121. Callithrix jacchus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  122. Callorhinchus milii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  123. Callorhinus ursinus (northern fur seal) tRNA
  124. Callosobruchus analis hypothetical protein
  125. Caloenas nicobarica tRNA
  126. Calonectris borealis (cory's shearwater) tRNA
  127. Calypte anna (Anna's hummingbird) tRNA
  128. Calyptomena viridis (green broadbill) tRNA
  129. Camarhynchus parvulus tRNA
  130. Camelus bactrianus (Bactrian camel) tRNA
  131. Camelus dromedarius (Arabian camel) tRNA
  132. Camelus ferus (Wild Bactrian camel) tRNA
  133. Campylorhamphus procurvoides tRNA
  134. Candidula unifasciata tRNA
  135. Canis lupus dingo (dingo) tRNA
  136. Canis lupus familiaris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  137. Capra hircus (goat) tRNA
  138. Antrostomus carolinensis tRNA
  139. Caranx melampygus tRNA-OTHER
  140. Carassius auratus (goldfish) tRNA
  141. Cardinalis cardinalis tRNA
  142. Cariama cristata (red-legged seriema) tRNA
  143. Carlito syrichta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  144. Castor canadensis (American beaver) tRNA
  145. Catagonus wagneri (Chacoan peccary) tRNA
  146. Cathartes aura (turkey vulture) tRNA
  147. Catharus fuscescens tRNA
  148. Catharus ustulatus tRNA
  149. Cavia porcellus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  150. Sapajus apella Cebus apella (Tufted capuchin) tRNA
  151. Cebus imitator (Panamanian white-faced capuchin) tRNA
  152. Centropus unirufus tRNA
  153. Cephalopterus ornatus (amazonian umbrellabird) tRNA
  154. Cephus cinctus (wheat stem sawfly) tRNA
  155. Cepphus grylle tRNA
  156. Ceratitis capitata tRNA-Gln
  157. Ceratotherium simum simum tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  158. Cercocebus atys (sooty mangabey) tRNA
  159. Tychaedon coryphoeus Cercotrichas coryphoeus (Karoo scrub-robin) tRNA
  160. Certhia brachydactyla tRNA
  161. Certhia familiaris tRNA
  162. Cervus elaphus hippelaphus tRNA
  163. Cervus hanglu yarkandensis Cervus elaphus yarkandensis tRNA
  164. Cettia cetti tRNA
  165. Chaetops frenatus (Rufous rock-jumper) tRNA
  166. Chaetorhynchus papuensis (pygmy drongo) tRNA
  167. Chaetura pelagica (chimney swift) tRNA
  168. Chamberlinius hualienensis tRNA-Gln
  169. Channa argus (snakehead) tRNA
  170. Chanos chanos (milkfish) tRNA
  171. Characodon lateralis tRNA-Gln
  172. Charadrius vociferus tRNA
  173. Chauna torquata (southern screamer) tRNA
  174. Chelonia mydas (green seaturtle) tRNA
  175. Chelydra serpentina (snapping turtle) tRNA
  176. Chiloscyllium punctatum (brownbanded bambooshark) tRNA
  177. Chinchilla lanigera tRNA
  178. Chionis minor (black-faced sheathbill) tRNA
  179. Chlamydotis macqueenii Chlamydotis undulata macqueenii tRNA
  180. Chlorocebus sabaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  181. Chloroceryle aenea tRNA
  182. Chloropsis cyanopogon tRNA
  183. Chloropsis hardwickii tRNA
  184. Choloepus hoffmanni tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  185. Chordeiles acutipennis (lesser nighthawk) tRNA
  186. Chrysemys picta bellii tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  187. Chrysochloris asiatica tRNA
  188. Chrysodeixis includens tRNA
  189. Chrysolophus pictus (golden pheasant) tRNA
  190. Chunga burmeisteri (black-legged seriema) tRNA
  191. Ciccaba nigrolineata tRNA
  192. Ciconia maguari tRNA
  193. Cinclus mexicanus tRNA
  194. Circaetus pectoralis tRNA
  195. Cisticola juncidis tRNA
  196. Clarias magur (asian catfish) tRNA
  197. Climacteris rufus Climacteris rufa (rufous treecreeper) tRNA
  198. Cnemophilus loriae (Loria's bird-of-paradise) tRNA
  199. Cnephaeus nilssonii tRNA-Gln
  200. Cochlearius cochlearius tRNA
  201. Colinus virginianus tRNA
  202. Colius striatus (speckled mousebird) tRNA
  203. Collichthys lucidus tRNA
  204. Colobus angolensis palliatus tRNA
  205. Columba livia (Rock pigeon) tRNA
  206. Columbina picui (picui ground-dove) tRNA
  207. Conger conger tRNA
  208. Copidosoma floridanum tRNA-Gln
  209. Copsychus sechellarum tRNA
  210. Cordylochernes scorpioides tRNA-Gln
  211. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015377.1
  212. Corvus brachyrhynchos (American crow) tRNA
  213. Corvus moneduloides (new caledonian crow) tRNA
  214. Corythaeola cristata (great blue turaco) tRNA
  215. Corythaixoides concolor (grey go-away-bird) tRNA
  216. Cottoperca gobio tRNA
  217. Coturnix japonica (Japanese quail) tRNA
  218. Gymnorhina tibicen Cracticus tibicen (Australian magpie) tRNA
  219. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  220. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon CUG)
  221. Crassostrea virginica tRNA-Gln
  222. Crenichthys baileyi tRNA-Gln
  223. Cricetulus griseus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  224. Crocodylus porosus (Australian saltwater crocodile) tRNA
  225. Crocuta crocuta (spotted hyena) tRNA
  226. Crotophaga sulcirostris (groove-billed ani) tRNA
  227. Crypturellus soui tRNA
  228. Crypturellus undulatus tRNA
  229. Ctenocephalides felis (Cat flea) tRNA-Gln
  230. Cuculus canorus tRNA
  231. Cyanistes caeruleus tRNA
  232. Cyclopterus lumpus tRNA
  233. Cydia pomonella (The codling moth) transfer RNA glutamine (anticodon CUG)
  234. Cylas formicarius (Sweet potato weevil) transfer RNA glutamine (anticodon CUG)
  235. Cynoglossus semilaevis (tongue sole) tRNA
  236. Cyphomyrmex costatus tRNA
  237. Cyprinodon variegatus tRNA
  238. Cyprinus carpio carpio tRNA
  239. Cyprinus carpio (common carp) tRNA
  240. Danaus chrysippus (African queen) tRNA
  241. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018367.1
  242. Danaus plexippus plexippus (Monarch butterfly) tRNA-Gln
  243. Danionella cerebrum tRNA-Gln
  244. Danionella translucida tRNA
  245. Danio rerio tRNA-Gln (CTG) (tRNA-Gln-CTG-4 1 to 58)
  246. Daphoenositta chrysoptera (varied sittella) tRNA
  247. Dasyornis broadbenti (rufous bristle-bird) tRNA
  248. Dasypus novemcinctus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  249. Daubentonia madagascariensis tRNA-Gln
  250. Delphinapterus leucas (beluga whale) tRNA
  251. Setophaga kirtlandii Dendroica kirtlandii (Kirtland's warbler) tRNA
  252. Denticeps clupeoides (denticle herring) tRNA
  253. Diatraea saccharalis (sugarcane borer) tRNA
  254. Dicaeum eximium tRNA
  255. Dicentrarchus labrax (European seabass) tRNA
  256. Diceros bicornis minor tRNA
  257. Dicrurus megarhynchus tRNA
  258. Dinoponera quadriceps (south american ant) tRNA
  259. Dipodomys ordii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  260. Dissostichus eleginoides tRNA-Gln
  261. Dissostichus mawsoni tRNA
  262. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  263. Donacobius atricapilla tRNA
  264. Dromaius novaehollandiae (emu) tRNA
  265. Dromas ardeola tRNA
  266. Drosophila albomicans (Fruit fly) transfer RNA glutamine (anticodon CUG)
  267. Drosophila ananassae tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  268. Drosophila arizonae (Fruit fly) tRNA-Gln
  269. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  270. Drosophila bipectinata (Pomace flies) transfer RNA glutamine (anticodon CUG)
  271. Drosophila busckii (Fruit fly) tRNA-Gln
  272. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  273. Drosophila eugracilis (Fruit fly) tRNA-Gln
  274. Drosophila ficusphila (Fruit fly) tRNA-Gln
  275. Drosophila grimshawi tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  276. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  277. Drosophila hydei (Fruit fly) tRNA-Gln
  278. Drosophila innubila (Fruit fly) tRNA-Gln
  279. Drosophila kikkawai (Pomace flies) transfer RNA glutamine (anticodon CUG)
  280. Drosophila mauritiana (Fruit fly) tRNA-Gln
  281. Drosophila melanogaster (fruit fly) transfer RNA:Glutamine-CTG 1-1 (Dmel_CR30237)
  282. Drosophila mojavensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  283. Drosophila montana (Pomace flies) transfer RNA glutamine (anticodon CUG)
  284. Drosophila nasuta (Pomace flies) transfer RNA glutamine (anticodon CUG)
  285. Drosophila navojoa (Fruit fly) tRNA-Gln
  286. Drosophila novamexicana (Pomace flies) tRNA-Gln
  287. Drosophila santomea (Fruit fly) tRNA-Gln
  288. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  289. Drosophila serrata (Pomace flies) tRNA-Gln
  290. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  291. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  292. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glutamine (anticodon CUG)
  293. Drosophila suzukii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  294. Drosophila takahashii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  295. Drosophila teissieri (Fruit fly) tRNA-Gln
  296. Drosophila virilis tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  297. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  298. Drymodes brunneopygia tRNA
  299. Dryococelus australis tRNA-OTHER
  300. Dryoscopus gambensis tRNA
  301. Echeneis naucrates (live sharksucker) tRNA
  302. Echinops telfairi tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  303. Edolisoma coerulescens tRNA
  304. Egretta garzetta tRNA
  305. Elachura formosa (spotted wren-babbler) tRNA
  306. Electrophorus electricus (electric eel) tRNA
  307. Elysia chlorotica (eastern emerald elysia) tRNA
  308. Emberiza fucata tRNA
  309. Enhydra lutris kenyoni tRNA
  310. Enterococcus faecalis tRNA-Gln
  311. Eolophus roseicapilla Eolophus roseicapillus (Galah) tRNA
  312. Eptatretus burgeri (inshore hagfish) tRNA
  313. Cnephaeus nilssonii Eptesicus nilssoni (northern bat) tRNA
  314. Equus asinus (ass) tRNA
  315. Equus caballus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  316. Erinaceus europaeus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  317. Erithacus rubecula (European robin) tRNA
  318. Erpetoichthys calabaricus (reedfish) tRNA
  319. Erpornis zantholeuca tRNA
  320. Erythrocercus mccallii tRNA
  321. Chloebia gouldiae Erythrura gouldiae (Gouldian finch) tRNA
  322. Etheostoma spectabile (orangethroat darter) tRNA
  323. Eubucco bourcierii (red-headed barbet) tRNA
  324. Eudromia elegans (elegant crested-tinamou) tRNA
  325. Eudyptes chrysocome (Rockhopper penguin) tRNA
  326. Eudyptula minor (little blue penguin) tRNA
  327. Eulacestoma nigropectus (wattled ploughbill) tRNA
  328. Calidris pygmaea Eurynorhynchus pygmeus tRNA
  329. Eurypyga helias (sunbittern) tRNA
  330. Eurystomus gularis tRNA
  331. Exocentrus adspersus tRNA-Gln
  332. Falco tinnunculus (common kestrel) tRNA
  333. Falcunculus frontatus (crested shrike-tit) tRNA
  334. Felis catus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  335. Ficedula albicollis tRNA
  336. Formicarius rufipectus tRNA
  337. Fregata magnificens tRNA
  338. Fregetta grallaria tRNA
  339. Frieseomelitta varia tRNA
  340. Fukomys damarensis (Damara mole-rat) tRNA
  341. Fulmarus glacialis (northern fulmar) tRNA
  342. Furnarius figulus tRNA
  343. Galbula dea tRNA
  344. Galemys pyrenaicus tRNA
  345. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  346. Galleria mellonella (greater wax moth) tRNA
  347. Pampusana beccarii Gallicolumba beccarii (bronze ground-dove) tRNA
  348. Gallus gallus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  349. Gambusia affinis (western mosquitofish) tRNA
  350. Gasterosteus aculeatus tRNA
  351. Gavia stellata tRNA
  352. Gekko kuhli tRNA-Gln
  353. Chelonoidis abingdonii Geochelone nigra abingdoni tRNA
  354. Geococcyx californianus tRNA
  355. Geospiza fortis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  356. Geotrypetes seraphini tRNA
  357. Glareola pratincola tRNA
  358. Glaucidium brasilianum (ferruginous pygmy-owl) tRNA
  359. Glossina austeni (Tsetse fly) tRNA tRNA-Gln
  360. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Gln
  361. Glossina fuscipes fuscipes tRNA
  362. Glossina fuscipes (Tsetse fly) tRNA-Gln
  363. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Gln
  364. Glossina pallidipes (Tsetse fly) tRNA tRNA-Gln
  365. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Gln
  366. Goodea atripinnis tRNA-Gln
  367. Gopherus agassizii (desert tortoise) tRNA
  368. Gopherus evgoodei (goodes thornscrub tortoise) tRNA
  369. Gorilla gorilla gorilla tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  370. Gouania willdenowi (blunt-snouted clingfish) tRNA
  371. Grallaria varia (variegated antpitta) tRNA
  372. Grantiella picta tRNA
  373. Grus americana (whooping crane) tRNA
  374. Gulo gulo (wolverine) tRNA
  375. Gymnodraco acuticeps tRNA
  376. Gymnothorax javanicus tRNA-Gln
  377. Halcyon senegalensis tRNA
  378. Haliaeetus albicilla (white-tailed eagle) tRNA
  379. Haplochromis burtoni tRNA
  380. Harpegnathos saltator tRNA-Gln
  381. Heliconius melpomene (Postman butterfly) tRNA HMEL017634
  382. Helicoverpa armigera (Cotton bollworm) transfer RNA glutamine (anticodon CUG)
  383. Helicoverpa zea (Corn earworm) tRNA-Gln
  384. Heliornis fulica (sungrebe) tRNA
  385. Heliothis virescens (tobacco budworm) tRNA
  386. Hemibagrus wyckioides tRNA
  387. Hemiprocne comata tRNA
  388. Henosepilachna vigintioctopunctata tRNA-Gln
  389. Herpetotheres cachinnans tRNA
  390. Heterocephalus glaber tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  391. Himantopus himantopus (black-winged stilt) tRNA
  392. Hippoglossus stenolepis tRNA-Gln
  393. Hippolais icterina (icterine warbler) tRNA
  394. Hipposideros armiger tRNA
  395. Hirundo rustica (Barn swallow) tRNA
  396. Hirundo rustica rustica tRNA
  397. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  398. Homo sapiens tRNA-Gln (anticodon CTG) 1-1 (TRQ-CTG1 1 to 5)
  399. Horornis vulcanius tRNA
  400. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon CUG)
  401. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA glutamine (anticodon CUG)
  402. Hylia prasina (green hylia) tRNA
  403. Hymenochirus boettgeri tRNA
  404. Hypocryptadius cinnamomeus tRNA
  405. Ibidorhyncha struthersii tRNA
  406. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005012187.1
  407. Ictidomys tridecemlineatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  408. Ifrita kowaldi (blue-capped ifrita) tRNA
  409. Ignelater luminosus (cucubano) tRNA
  410. Illadopsis cleaveri (blackcap illadopsis) tRNA
  411. Ilyodon furcidens tRNA-Gln
  412. Indicator maculatus tRNA
  413. Inia geoffrensis tRNA-Gln
  414. Irena cyanogastra Irena cyanogaster tRNA
  415. Ischnura elegans (Damselflies) tRNA-Gln
  416. Jacana jacana (wattled jacana) tRNA
  417. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  418. Junco hyemalis (dark-eyed junco) tRNA
  419. Kryptolebias marmoratus (mangrove rivulus) tRNA
  420. Labeo rohita (rohu) tRNA
  421. Labrus bergylta (ballan wrasse) tRNA
  422. Lamprotornis superbus tRNA
  423. Lanius ludovicianus tRNA
  424. Larimichthys crocea tRNA
  425. Larus smithsonianus tRNA
  426. Lates calcarifer (barramundi perch) tRNA
  427. Laticauda laticaudata (blue-ringed sea krait) tRNA
  428. Latimeria chalumnae tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  429. Leguminivora glycinivorella (Soybean pod borer) tRNA-Gln
  430. Leiothrix lutea (red-billed leiothrix) tRNA
  431. Lepidothrix coronata tRNA
  432. Lepisosteus oculatus tRNA
  433. Leptidea sinapis tRNA
  434. Leptinotarsa decemlineata tRNA-Gln
  435. Leptobrachium leishanense (Leishan spiny toad) tRNA
  436. Leptocoma aspasia tRNA
  437. Leptonychotes weddellii (Weddell seal) tRNA
  438. Leptosomus discolor tRNA
  439. Leucopsar rothschildi tRNA
  440. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068927.1
  441. Limulus polyphemus (Atlantic horseshoe crab) tRNA-Gln
  442. Lingula anatina (Lamp shell) tRNA-Gln
  443. Liolophura japonica (Chitons) transfer RNA glutamine (anticodon CUG)
  444. Lipotes vexillifer (Yangtze River dolphin) tRNA
  445. Helopsaltes ochotensis Locustella ochotensis tRNA
  446. Lonchura striata tRNA
  447. Lophotis ruficrista tRNA
  448. Loxia curvirostra tRNA
  449. Loxia leucoptera tRNA
  450. Loxodonta africana tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  451. Lucilia cuprina (Australian sheep blowfly) tRNA-Gln for anticodon CUG
  452. Lucilia sericata (Common green bottle fly) tRNA-Gln
  453. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Gln
  454. Lycocorax pyrrhopterus obiensis tRNA-Gln
  455. Lynx canadensis (Canada lynx) tRNA
  456. Lynx pardinus (Spanish lynx) tRNA
  457. Macaca fascicularis (crab-eating macaque) tRNA
  458. Macaca mulatta tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  459. Macaca nemestrina (pig-tailed macaque) tRNA
  460. Machaerirhynchus nigripectus tRNA
  461. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011443.1
  462. Magallana gigas (Pacific oyster) transfer RNA glutamine (anticodon CUG)
  463. Malurus cyaneus samueli tRNA
  464. Malurus elegans (Red-winged fairywren) tRNA
  465. Manacus vitellinus (golden-collared manakin) tRNA
  466. Mandrillus leucophaeus (drill) tRNA
  467. Manduca sexta (Tobacco hornworm) tRNA-Gln
  468. Marmota marmota marmota (Alpine marmot) tRNA
  469. Marmota monax tRNA
  470. Mastacembelus armatus tRNA
  471. Mauremys mutica tRNA
  472. Maylandia zebra (zebra mbuna) tRNA
  473. Megachile rotundata tRNA-Gln
  474. Megalops atlanticus (tarpon) tRNA
  475. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  476. Melanocharis versteri (fan-tailed berrypecker) tRNA
  477. Meleagris gallopavo tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  478. Melipona bicolor tRNA
  479. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023534.1
  480. Melopsittacus undulatus (budgerigar) tRNA
  481. Melospiza melodia (song sparrow) tRNA
  482. Menidia menidia (Atlantic silverside) tRNA
  483. Menura novaehollandiae (superb lyrebird) tRNA
  484. Merluccius polli (Benguela hake) tRNA
  485. Merops nubicus tRNA
  486. Mesembrinibis cayennensis tRNA
  487. Mesitornis unicolor (brown roatelo) tRNA
  488. Mesocricetus auratus (golden hamster) tRNA
  489. Microcaecilia unicolor tRNA
  490. Microcebus murinus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  491. Microtus ochrogaster (prairie vole) tRNA
  492. Mimus melanotis tRNA-Gln
  493. Mionectes macconnelli (McConnell's flycatcher) tRNA
  494. Mohoua ochrocephala tRNA
  495. Mola mola (ocean sunfish) tRNA
  496. Molorchus minor tRNA-Gln
  497. Molossus molossus (Pallas's mastiff bat) tRNA
  498. Molothrus ater tRNA
  499. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  500. Monodelphis domestica tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  501. Monodon monoceros (narwhal) tRNA
  502. Monomorium pharaonis tRNA-Gln
  503. Moschus moschiferus (Siberian musk deer) tRNA
  504. Motacilla alba tRNA
  505. Muntiacus reevesi (Chinese muntjac) tRNA
  506. Musca domestica (House fly) transfer RNA glutamine (anticodon CUG)
  507. Mus caroli tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  508. Mus musculus castaneus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  509. Mus musculus domesticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  510. Mus musculus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  511. Mus musculus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4, tRNA-Gln-CTG-3 1 to 4)
  512. Mus pahari tRNA-Gln (CTG) (tRNA-Gln-CTG-3 1 to 4)
  513. Mus spicilegus (steppe mouse) tRNA
  514. Mus spretus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  515. Mustela putorius furo tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  516. Myiagra hebetior tRNA
  517. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013574.1
  518. Myotis brandtii tRNA
  519. Myotis davidii tRNA
  520. Myotis lucifugus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  521. Myotis myotis tRNA
  522. Myripristis murdjan (pinecone soldierfish) tRNA
  523. Mystacornis crossleyi tRNA
  524. Mytilus californianus (California mussel) transfer RNA glutamine (anticodon CUG)
  525. Mytilus coruscus tRNA
  526. Mytilus edulis tRNA
  527. Mytilus galloprovincialis tRNA
  528. Naja naja tRNA
  529. Nannospalax galili (Upper Galilee mountains blind mole rat) tRNA
  530. Nasonia vitripennis tRNA-Gln
  531. Neodrepanis coruscans (wattled asity) tRNA
  532. Neogobius melanostomus (round goby) tRNA
  533. Neolamprologus brichardi tRNA
  534. Neophocaena asiaeorientalis asiaeorientalis (yangtze finless porpoise) tRNA
  535. Neopipo cinnamomea tRNA
  536. Neotoma lepida tRNA
  537. Neogale vison Neovison vison tRNA
  538. Nephila pilipes tRNA
  539. Nesidiocoris tenuis tRNA
  540. Nesospiza acunhae tRNA
  541. Nestor notabilis tRNA
  542. Nicator chloris tRNA
  543. Nipponia nippon (crested ibis) tRNA
  544. Nomascus leucogenys tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  545. Notamacropus eugenii tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2)
  546. Notechis scutatus tRNA
  547. Nothobranchius furzeri tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  548. Nothocercus julius tRNA
  549. Nothoprocta ornata tRNA
  550. Nothoprocta perdicaria tRNA
  551. Notiomystis cincta tRNA
  552. Notothenia coriiceps (black rockcod) tRNA
  553. Nyctereutes procyonoides (raccoon dog) tRNA
  554. Nyctibius bracteatus tRNA
  555. Nyctibius grandis tRNA
  556. Nycticryphes semicollaris tRNA
  557. Nyctiprogne leucopyga tRNA
  558. Oceanites oceanicus tRNA
  559. Oceanodroma tethys tRNA
  560. Ochotona princeps tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  561. Octodon degus (degu) tRNA
  562. Odobenus rosmarus divergens (Pacific walrus) tRNA
  563. Odocoileus virginianus texanus tRNA
  564. Odontophorus gujanensis (marbled wood quail) tRNA
  565. Oenanthe oenanthe (Northern wheatear) tRNA
  566. Onychorhynchus coronatus tRNA
  567. Onychostoma macrolepis tRNA
  568. Ooceraea biroi tRNA-Gln
  569. Ophiophagus hannah tRNA
  570. Opisthocomus hoazin tRNA
  571. Oreocharis arfaki tRNA
  572. Oreochromis aureus tRNA
  573. Oreochromis niloticus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  574. Oreotrochilus melanogaster tRNA
  575. Origma solitaria tRNA
  576. Oriolus oriolus tRNA
  577. Ornithodoros turicata (Softbacked ticks) transfer RNA glutamine (anticodon CUG)
  578. Ornithorhynchus anatinus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  579. Orthonyx spaldingii (northern chowchilla) tRNA
  580. Orussus abietinus (Parasitic wood wasp) tRNA-Gln
  581. Orycteropus afer afer tRNA
  582. Oryctolagus cuniculus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  583. Oryzias javanicus tRNA
  584. Oryzias latipes tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  585. Oryzias melastigma (Indian medaka) tRNA
  586. Oryzias sinensis tRNA
  587. Ostrea edulis (Mud oyster) transfer RNA glutamine (anticodon CUG)
  588. Otolemur garnettii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  589. Otus sunia (Oriental scops-owl) tRNA
  590. Ovis aries tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  591. Oxyruncus cristatus (sharpbill) tRNA
  592. Pachycephala philippinensis tRNA
  593. Pachyramphus minor tRNA
  594. Pandion haliaetus tRNA
  595. Pangasianodon gigas (Mekong giant catfish) tRNA-Gln
  596. Pangasianodon hypophthalmus tRNA
  597. Pangasius djambal tRNA-Gln
  598. Pan paniscus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 5)
  599. Panthera leo (lion) tRNA
  600. Panthera tigris altaica (Amur tiger) tRNA
  601. Pantherophis guttatus tRNA
  602. Pan troglodytes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  603. Panurus biarmicus tRNA
  604. Papilio machaon tRNA
  605. Papilio xuthus tRNA
  606. Papio anubis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  607. Sinosuthora webbiana Paradoxornis webbianus tRNA
  608. Arctia plantaginis Parasemia plantaginis tRNA
  609. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  610. Pardalotus punctatus (spotted pardalote) tRNA
  611. Parnassius apollo (apollo) tRNA
  612. Passerina amoena tRNA
  613. Patagioenas fasciata monilis tRNA
  614. Pavo cristatus (Indian peafowl) tRNA
  615. Pectinophora gossypiella (Pink bollworm) transfer RNA glutamine (anticodon CUG)
  616. Pelecanoides urinatrix tRNA
  617. Pelecanus crispus tRNA
  618. Pelobates cultripes tRNA.Gln
  619. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  620. Pelusios castaneus tRNA
  621. Penelope pileata tRNA
  622. Perca flavescens (yellow perch) tRNA
  623. Perca fluviatilis tRNA
  624. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  625. Peromyscus maniculatus sonoriensis tRNA-Gln
  626. Peucedramus taeniatus (olive warbler) tRNA
  627. Phaethon lepturus tRNA
  628. Phaetusa simplex (large-billed tern) tRNA
  629. Phainopepla nitens tRNA
  630. Phalacrocorax carbo tRNA
  631. Phascolarctos cinereus (koala) tRNA
  632. Phasianus colchicus (Ring-necked pheasant) tRNA
  633. Pheucticus melanocephalus tRNA
  634. Phlebotomus argentipes (Sand fly) transfer RNA glutamine (anticodon CUG)
  635. Phlebotomus papatasi tRNA tRNA-Gln
  636. Phocoena sinus (vaquita) tRNA
  637. Phoenicopterus ruber ruber tRNA
  638. Photinus pyralis (Common eastern firefly) tRNA-Gln
  639. Phrynocephalus forsythii tRNA
  640. Phrynosoma platyrhinos tRNA-OTHER
  641. Phthorimaea operculella tRNA-Gln
  642. Phyllostomus discolor (pale spear-nosed bat) tRNA
  643. Physeter macrocephalus Physeter catodon (sperm whale) tRNA
  644. Piaya cayana (squirrel cuckoo) tRNA
  645. Picathartes gymnocephalus tRNA
  646. Dryobates pubescens Picoides pubescens (downy woodpecker) tRNA
  647. Pieris brassicae (large cabbage white) tRNA
  648. Pieris macdunnoughi tRNA
  649. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  650. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  651. Pipra filicauda tRNA
  652. Piprites chloris (white-winged piprites) tRNA
  653. Pitta sordida (hooded pitta) tRNA
  654. Platysteira castanea tRNA
  655. Platysternon megacephalum (big-headed turtle) tRNA
  656. Plecturocebus cupreus tRNA-OTHER
  657. Ploceus nigricollis tRNA
  658. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon CUG)
  659. Plutella xylostella (diamondback moth) tRNA
  660. Pluvianellus socialis (magellanic plover) tRNA
  661. Podarcis lilfordi tRNA
  662. Podarcis muralis tRNA
  663. Podargus strigoides (tawny frogmouth) tRNA
  664. Podiceps cristatus (great crested grebe) tRNA
  665. Podilymbus podiceps tRNA
  666. Poecile atricapillus Poecile atricapilla (Black-capped chickadee) tRNA
  667. Poecilia formosa tRNA
  668. Poecilia reticulata (guppy) tRNA
  669. Pogona vitticeps (central bearded dragon) tRNA
  670. Pogonomyrmex californicus tRNA-Gln
  671. Polioptila caerulea tRNA
  672. Polypterus senegalus tRNA
  673. Pomacea canaliculata (Apple snail) tRNA-Gln
  674. Pomatorhinus ruficollis tRNA
  675. Pomatostomus ruficeps (chestnut-crowned babbler) tRNA
  676. Pongo abelii tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 3)
  677. Potamilus streckersoni tRNA-Gln
  678. Probosciger aterrimus tRNA
  679. Procavia capensis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  680. Prolemur simus (greater bamboo lemur) tRNA
  681. Promerops cafer (Cape sugarbird) tRNA
  682. Propithecus coquereli (Coquerel's sifaka) tRNA
  683. Prunella fulvescens tRNA
  684. Prunella himalayana tRNA
  685. Parambassis ranga Pseudambassis ranga (Indian glassy fish) tRNA
  686. Pseudoatta argentina tRNA
  687. Pseudomonas sp. PHC1 tRNA-Gln
  688. Pseudonaja textilis tRNA
  689. Psilopogon haemacephalus tRNA
  690. Psophia crepitans (common trumpeter) tRNA
  691. Pterocles burchelli tRNA
  692. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  693. Pteropus alecto (black flying fox) tRNA
  694. Pteropus vampyrus (large flying fox) tRNA
  695. Pteruthius melanotis tRNA
  696. Ptilonorhynchus violaceus (satin bowerbird) tRNA
  697. Ptilorrhoa leucosticta tRNA
  698. Puma concolor (puma) tRNA
  699. Pundamilia nyererei tRNA
  700. Brachypodius melanocephalos Pycnonotus atriceps tRNA
  701. Pycnonotus jocosus tRNA
  702. Pygoscelis adeliae (Adelie penguin) tRNA
  703. Pygoscelis papua tRNA
  704. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  705. Quiscalus mexicanus tRNA
  706. Ramphastos sulfuratus tRNA
  707. Aquarana catesbeiana Rana catesbeiana (bullfrog) tRNA
  708. Rattus norvegicus tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1, tRNA-Gln-CTG-2-2, tRNA-Gln-CTG-4-1)
  709. Regulus satrapa (golden-crowned kinglet) tRNA
  710. Rhabdornis inornatus tRNA
  711. Rhadina sibilatrix tRNA
  712. Rhagoletis pomonella tRNA-Gln
  713. Rhagologus leucostigma tRNA
  714. Rhinolophus ferrumequinum (greater horseshoe bat) tRNA
  715. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  716. Rhinopithecus roxellana (golden snub-nosed monkey) tRNA
  717. Rhinopomastus cyanomelas (common scimitar-bill) tRNA
  718. Rhipidura dahli tRNA
  719. Rhodinocichla rosea tRNA
  720. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Gln
  721. Rhynchophorus ferrugineus (red palm weevil) tRNA
  722. Rhynochetos jubatus (kagu) tRNA
  723. Rissa tridactyla (black-legged kittiwake) tRNA
  724. Rostratula benghalensis (greater painted-snipe) tRNA
  725. Rousettus aegyptiacus (Egyptian rousette) tRNA
  726. Rynchops niger (black skimmer) tRNA
  727. Sagittarius serpentarius tRNA
  728. Saimiri boliviensis boliviensis tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  729. Sakesphorus luctuosus tRNA
  730. Salarias fasciatus (jewelled blenny) tRNA
  731. Sander lucioperca (pike-perch) tRNA
  732. Sapayoa aenigma (broad-billed sapayoa) tRNA
  733. Sarcophilus harrisii tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  734. Sciurus carolinensis (gray squirrel) tRNA
  735. Sciurus vulgaris (Eurasian red squirrel) tRNA
  736. Scleropages formosus tRNA
  737. Sclerurus mexicanus (tawny-throated leaftosser) tRNA
  738. Scophthalmus maximus (turbot) tRNA
  739. Scopus umbretta (hamerkop) tRNA
  740. Scyliorhinus torazame (cloudy catshark) tRNA
  741. Scytalopus superciliaris tRNA
  742. Semnornis frantzii tRNA
  743. Serilophus lunatus (silver-breasted broadbill) tRNA
  744. Serinus canaria (common canary) tRNA
  745. Sigmodon hispidus tRNA-Gln
  746. Silurus meridionalis tRNA
  747. Sinocyclocheilus anshuiensis tRNA
  748. Sinocyclocheilus grahami tRNA
  749. Sinocyclocheilus rhinocerous tRNA
  750. Sitophilus oryzae tRNA-Gln
  751. Sitta europaea (wood nuthatch) tRNA
  752. Smithornis capensis tRNA
  753. Solenopsis invicta (Red fire ant) tRNA-Gln
  754. Sorex araneus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  755. Sousa chinensis (Indo-pacific humpbacked dolphin) tRNA
  756. Sparus aurata (gilthead seabream) tRNA
  757. Spermophilus dauricus (Daurian ground squirrel) tRNA
  758. Urocitellus parryii Spermophilus parryii (Arctic ground squirrel) tRNA
  759. Sphaeramia orbicularis tRNA
  760. Sphaerodactylus townsendi tRNA-Gln
  761. Sphenodon punctatus (tuatara) tRNA
  762. Spizaetus tyrannus (black hawk-eagle) tRNA
  763. Spizella passerina (chipping sparrow) tRNA
  764. Spodoptera exigua (beet armyworm) tRNA
  765. Spodoptera frugiperda tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 3)
  766. Spodoptera littoralis tRNA
  767. Spodoptera litura tRNA
  768. Steatornis caripensis (oilbird) tRNA
  769. Stegastes partitus (bicolor damselfish) tRNA
  770. Stegodyphus dumicola (Social spider) tRNA-Gln
  771. Stegodyphus mimosarum tRNA-Gln for anticodon CUG
  772. Stercorarius parasiticus tRNA
  773. Sterrhoptilus dennistouni tRNA
  774. Stomoxys calcitrans (stable fly) transfer RNA glutamine (anticodon CUG)
  775. Strigops habroptila (kakapo) tRNA
  776. Strix occidentalis caurina tRNA
  777. Struthidea cinerea tRNA
  778. Struthio camelus australis tRNA
  779. Sula dactylatra tRNA
  780. Suricata suricatta (meerkat) tRNA
  781. Sus scrofa tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 4)
  782. Sylvia atricapilla (blackcap) tRNA
  783. Sylvia borin tRNA
  784. Sylvietta virens (green crombec) tRNA
  785. Symphalangus syndactylus tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 4)
  786. Synaphobranchus kaupii (Kaup's arrowtooth eel) tRNA
  787. Syrrhaptes paradoxus (Pallas's sandgrouse) tRNA
  788. Tachuris rubrigastra tRNA
  789. Taeniopygia guttata tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1, tRNA-Gln-CTG-1-2)
  790. Takifugu bimaculatus tRNA
  791. Takifugu flavidus tRNA
  792. Takifugu rubripes tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 7)
  793. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Gln
  794. Temnothorax curvispinosus tRNA
  795. Temnothorax longispinosus tRNA
  796. Tenebrio molitor (yellow mealworm) tRNA
  797. Terrapene triunguis Terrapene carolina triunguis (three-toed box turtle) tRNA
  798. Tetraodon nigroviridis tRNA
  799. Thalassarche chlororhynchos tRNA
  800. Thamnophis sirtalis tRNA
  801. Theropithecus gelada (gelada baboon) tRNA
  802. Thinocorus orbignyianus tRNA
  803. Thryothorus ludovicianus tRNA
  804. Tichodroma muraria tRNA
  805. Tinamus guttatus tRNA
  806. Todus mexicanus (puerto rican tody) tRNA
  807. Toxostoma redivivum tRNA
  808. Trachymyrmex cornetzi tRNA
  809. Trachymyrmex septentrionalis tRNA
  810. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  811. Trichechus manatus latirostris tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  812. Trichogramma brassicae tRNA
  813. Trichogramma pretiosum tRNA-Gln
  814. Tricholaema leucomelas (pied barbet) tRNA
  815. Trichomalopsis sarcophagae tRNA
  816. Trichonephila clavata (joro spider) tRNA
  817. Trichonephila clavipes (golden silk orbweaver) tRNA
  818. Trichonephila inaurata madagascariensis tRNA
  819. Trichoplusia ni (cabbage looper) tRNA
  820. Triplophysa rosa (cave loach) tRNA
  821. Triplophysa tibetana tRNA
  822. Trogon melanurus (black-tailed trogon) tRNA
  823. Tropilaelaps mercedesae tRNA
  824. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  825. Salvator merianae Tupinambis merianae tRNA
  826. Turdus rufiventris tRNA-Gln
  827. Turnix velox (little buttonquail) tRNA
  828. Tursiops truncatus tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  829. Tyrannus savana (fork-tailed flycatcher) tRNA
  830. Tyto alba tRNA
  831. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon CUG)
  832. Upupa epops (Eurasian hoopoe) tRNA
  833. Urocolius indicus tRNA
  834. Urocynchramus pylzowi tRNA
  835. Ursus americanus (American black bear) tRNA
  836. Ursus maritimus (polar bear) tRNA
  837. Vanessa tameamea tRNA
  838. Varanus komodoensis tRNA
  839. Varroa destructor tRNA-Gln
  840. Varroa jacobsoni (Varroa mite) tRNA-Gln
  841. Venturia canescens (Endoparasitoid wasp) tRNA-Gln
  842. Vicugna pacos tRNA-Gln (CTG) (tRNA-Gln-CTG-1 1 to 5)
  843. Vidua chalybeata tRNA
  844. Vidua macroura tRNA
  845. Vireo altiloquus (black-whiskered vireo) tRNA
  846. Vombatus ursinus (common wombat) tRNA
  847. Vulpes vulpes (red fox) tRNA
  848. Xenoophorus captivus tRNA-Gln
  849. Xenopus laevis (African clawed frog) tRNA
  850. Xenopus petersii tRNA-Gln
  851. Xenopus tropicalis tRNA-Gln (CTG) (tRNA-Gln-CTG-2 1 to 31)
  852. Xenotaenia resolanae tRNA-Gln
  853. Xiphophorus maculatus (southern platyfish) tRNA
  854. Xiphorhynchus elegans (elegant woodcreeper) tRNA
  855. Zapornia atra tRNA
  856. Zerene cesonia tRNA-Gln
  857. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamine (anticodon CUG)
  858. Zonotrichia albicollis tRNA
  859. Zophobas morio tRNA
  860. Zosterops borbonicus tRNA
  861. Zosterops hypoxanthus tRNA
  862. Zosterops lateralis melanops tRNA
Relationships

Molecular Relationships