Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-148a-3p URS00003BBF48_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MirGeneDB, RefSeq, miRBase, IntAct, PSICQUIC, MalaCards, GeneCards, LncBase, ENA, TarBase). Homo sapiens (human) hsa-miR-148a-3p sequence is a product of hsa-miR-148a-3p, miR-148a-3p, MIR148A, miR-148, hsa-miR-148a, miR-148a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3GAMMA, 14-3-3γ, 156DAG, 182-FIP, 20D7-FC4, 2C4D, 2H9, 2PP2A, 30K.

Interactions 17

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-148a-3p interacts with:

Interaction id Participant Synonyms
EBI-20559841 intact:EBI-20559808 EBI-20559808 ENST00000406246.7 mrna_rela
EBI-21019564 intact:EBI-21019567 EBI-21019567 ENST00000366929 mrna_tgfb2
EBI-26972197 intact:EBI-26972157 EBI-26972157 ENST00000291270 mrna_dmpk
EBI-26972179 intact:EBI-26972157 EBI-26972157 ENST00000291270 mrna_dmpk
URS00003BBF48_9606-7 O75469 O75469
URS00003BBF48_9606-6 O75469 O75469
URS00003BBF48_9606-0 O95477 O95477
URS00003BBF48_9606-1 O95477 O95477
URS00003BBF48_9606-8 O95477 O95477
URS00003BBF48_9606-9 O95477 O95477
URS00003BBF48_9606-2 P01130 P01130
URS00003BBF48_9606-10 P01130 P01130
URS00003BBF48_9606-3 P01130 P01130
URS00003BBF48_9606-4 P04156 P04156
URS00003BBF48_9606-11 P04156 P04156
URS00003BBF48_9606-12 P26358 P26358
URS00003BBF48_9606-5 P26358 P26358

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCAGUGCACUACAGAACUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Anolis carolinensis aca-miR-148a-3p
    2. Bos taurus bta-miR-148a
    3. Callithrix jacchus cja-miR-148a
    4. Callorhinchus milii Cmi-Mir-148-P1_3p (mature (guide))
    5. Canis lupus familiaris cfa-miR-148a
    6. Capra hircus (goat) chi-miR-148a-3p
    7. Cavia porcellus cpo-miR-148a-3p
    8. Cervus elaphus (red deer) cel-miR-148a
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P1_3p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-148a-3p
    11. Columba livia (rock pigeon) cli-miR-148a-3p
    12. Cricetulus griseus (Chinese hamster) cgr-miR-148a
    13. Dasypus novemcinctus dno-miR-148a-3p
    14. Echinops telfairi Ete-Mir-148-P1_3p (mature (guide))
    15. Equus caballus eca-miR-148a
    16. Gallus gallus (chicken) gga-miR-148a-3p
    17. Gekko japonicus Gja-Mir-148-P1_3p (mature (guide))
    18. Latimeria chalumnae Lch-Mir-148-P1_3p (mature (guide))
    19. Macaca mulatta (Rhesus monkey) mml-miR-148a-3p
    20. Microcaecilia unicolor Mun-Mir-148-P1_3p (mature (guide))
    21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-148-3p
    22. Mus musculus mmu-miR-148a-3p
    23. Ornithorhynchus anatinus (platypus) oan-miR-148-3p
    24. Oryctolagus cuniculus ocu-miR-148a-3p
    25. Ovis aries (sheep) oar-miR-148a
    26. Pan troglodytes ptr-miR-148a
    27. Pongo pygmaeus ppy-miR-148a
    28. Pteropus alecto pal-miR-148a-3p
    29. Python bivittatus (Burmese python) pbv-miR-148a-3p
    30. Rattus norvegicus (Norway rat) Rno-Mir-148-P1_3p (mature (guide))
    31. Saimiri boliviensis boliviensis sbo-miR-148a
    32. Scyliorhinus torazame Sto-Mir-148-P1_3p (mature (guide))
    33. Sphenodon punctatus (tuatara) Spt-Mir-148-P1_3p (mature (guide))
    34. Sus scrofa (pig) ssc-miR-148a-3p
    35. Taeniopygia guttata (zebra finch) tgu-miR-148a-3p
    36. Tupaia chinensis tch-miR-148a-3p
    37. Xenopus laevis Xla-Mir-148-P1b_3p (mature (guide))
    38. Xenopus tropicalis xtr-miR-148a
    Publications New