Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-122-5p URS00003380CC_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, LncBase, miRBase, TarBase, RefSeq, GeneCards, MalaCards, MirGeneDB). Homo sapiens (human) hsa-miR-122-5p sequence is a product of miR-122, hsa-miR-122, miR-122-5p, hsa-miR-122-5p, MIR122 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F10.1, 12CC4, 1A1-3B, 2C18, 2PP2A, 30K, 39K2, 3D3, 3G2, 3pK.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGAGUGUGACAAUGGUGUUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Alligator mississippiensis ami-miR-122-5p
    2. Anolis carolinensis (green anole) aca-miR-122-5p
    3. Bos taurus (cattle) bta-miR-122
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
    5. Canis lupus familiaris (dog) cfa-miR-122
    6. Capra hircus chi-miR-122
    7. Cavia porcellus cpo-miR-122-5p
    8. Cervus elaphus cel-miR-122
    9. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
    10. Chrysemys picta cpi-miR-122-5p
    11. Columba livia (rock pigeon) cli-miR-122-5p
    12. Danio rerio dre-miR-122
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-122-5p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
    15. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
    16. Equus caballus eca-miR-122
    17. Gadus morhua (Atlantic cod) gmo-miR-122-5p
    18. Gallus gallus Gga-Mir-122-P1_5p (mature (guide))
    19. Gekko japonicus Gja-Mir-122_5p (mature (guide))
    20. Gorilla gorilla ggo-miR-122
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
    22. Macaca mulatta mml-miR-122a-5p
    23. Maylandia zebra mze-miR-122
    24. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
    25. Monopterus albus (swamp eel) Mal-Mir-122_5p (mature (guide))
    26. Mus musculus mmu-miR-122-5p
    27. Neolamprologus brichardi nbr-miR-122
    28. Oreochromis niloticus oni-miR-122
    29. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
    30. Oryctolagus cuniculus ocu-miR-122-5p
    31. Pan troglodytes (chimpanzee) ptr-miR-122
    32. Paralichthys olivaceus pol-miR-122-5p
    33. Pongo pygmaeus (Bornean orangutan) ppy-miR-122
    34. Pteropus alecto (black flying fox) pal-miR-122-5p
    35. Pundamilia nyererei pny-miR-122
    36. Python bivittatus (Burmese python) pbv-miR-122-5p
    37. Rattus norvegicus rno-miR-122-5p
    38. Salmo salar (Atlantic salmon) ssa-miR-122-5p
    39. Sarcophilus harrisii Sha-Mir-122_5p (mature (guide))
    40. Sphenodon punctatus (tuatara) Spt-Mir-122_5p (mature (guide))
    41. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
    42. Takifugu rubripes (torafugu) fru-miR-122
    43. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
    44. Tor tambroides miR-122
    45. Tursiops truncatus (common bottlenose dolphin) miR-122-5p
    46. Xenopus laevis (African clawed frog) Xla-Mir-122-P6_5p (mature (guide))
    47. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
    Publications New