Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-122 URS00003380CC_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-122: Dre-mir-122 is a specific type of microRNA that is associated with the liver in zebrafish [PMC5308255]. In a study, it was found that the expression of dre-mir-122 was down-regulated in the liver of zebrafish injected with MCs [PMC5308255]. Other miRNAs, such as dre-miR-21 and dre-miR-27b, were found to be elevated in expression levels in the liver [PMC5308255]. Dre-mir-122 was also found to be upregulated after exposure to BPA in adult male zebrafish liver [PMC5664119]. In another study, it was observed that dre-mir-122 upregulation was associated with dysregulated metabolism and apoptosis in the liver of gankyrin transgenic zebrafish [PMC5664119]. Dre-mir-122 is specific to the liver, while other miRNAs such as dre-miR-135c and dre-miR-734 are highly expressed in the brain, and dre-miR-499 is enriched in the heart [PMC4647824]. In a comparison between male and female groups, it was found that dre-mir-122 expression was higher in ovaries compared to testes [PMC9495813]. Furthermore, RNA sequencing analysis revealed that TnP treatment altered gene expression levels including upregulation of miRNAs such as miR-21 and miR-26 (dre-miR) [PMC8268205]. Dre-mir-122 also showed differential expression during A. salmonicida infection in S. maximus spleen [PMC8301059]. In summary, dre-mir-122 is a specific microRNA associated with the liver. Its expression can be influenced by various factors such as exposure to BPA or infection. It plays a role in liver metabolism and apoptosis and shows differential expression in different tissues and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Bos taurus (cattle) bta-miR-122
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  5. Canis lupus familiaris (dog) cfa-miR-122
  6. Capra hircus chi-miR-122
  7. Cavia porcellus cpo-miR-122-5p
  8. Cervus elaphus (red deer) cel-miR-122
  9. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
  10. Chrysemys picta cpi-miR-122-5p
  11. Columba livia (rock pigeon) cli-miR-122-5p
  12. Dasypus novemcinctus dno-miR-122-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-122
  16. Gadus morhua gmo-miR-122-5p
  17. Gallus gallus (chicken) Gga-Mir-122-P1_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  20. Gorilla gorilla ggo-miR-122
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  22. Homo sapiens hsa-miR-122-5p
  23. Macaca mulatta mml-miR-122a-5p
  24. Maylandia zebra mze-miR-122
  25. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  26. Monopterus albus Mal-Mir-122_5p (mature (guide))
  27. Mus musculus mmu-miR-122-5p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  29. Oreochromis niloticus (Nile tilapia) oni-miR-122
  30. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  32. Pan troglodytes (chimpanzee) ptr-miR-122
  33. Paralichthys olivaceus (Japanese flounder) pol-miR-122-5p
  34. Pongo pygmaeus ppy-miR-122
  35. Pteropus alecto pal-miR-122-5p
  36. Pundamilia nyererei pny-miR-122
  37. Python bivittatus (Burmese python) pbv-miR-122-5p
  38. Rattus norvegicus rno-miR-122-5p
  39. Salmo salar ssa-miR-122-5p
  40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  43. Takifugu rubripes fru-miR-122
  44. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  45. Tor tambroides miR-122
  46. Tursiops truncatus miR-122-5p
  47. Xenopus laevis Xla-Mir-122-P6_5p (mature (guide))
  48. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Publications