Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-122-5p URS00003380CC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-122: Hsa-mir-122 is a microRNA that plays a significant role in the occurrence and development of lung adenocarcinoma [PMC8943533]. This microRNA and its related genes offer potential targets for the targeted therapy of lung cancer and other types of tumors [PMC8943533]. In the context of microRNA-gene networks, hsa-mir-122 is identified as one of the key microRNAs, along with hsa-miR-570, hsa-miR-34b, hsa-miR-29c, hsa-miR-922, and hsa-miR-185 [PMC4121398]. These microRNAs negatively regulate approximately 79 downstream target genes that are involved in modulating hepatocyte immune response, inflammatory response, and glutathione metabolism [PMC4121398]. The regulation of these processes by these key microRNAs suggests their potential role in modulating tumor development and progression [PMC4121398]. The identification of these key microRNAs provides new insights into the molecular mechanisms underlying lung adenocarcinoma and offers potential targets for therapeutic interventions [PMC4121398]. By targeting these specific microRNAs or their downstream target genes, it may be possible to modulate immune response, inflammatory response, and glutathione metabolism to inhibit tumor growth or enhance therapeutic efficacy [PMC4121398]. These findings contribute to our understanding of the molecular mechanisms involved in lung adenocarcinoma development and provide new avenues for targeted therapy research [PMC4121398].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Bos taurus (cattle) bta-miR-122
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  5. Canis lupus familiaris (dog) cfa-miR-122
  6. Capra hircus chi-miR-122
  7. Cavia porcellus cpo-miR-122-5p
  8. Cervus elaphus (red deer) cel-miR-122
  9. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
  10. Chrysemys picta cpi-miR-122-5p
  11. Columba livia (rock pigeon) cli-miR-122-5p
  12. Danio rerio dre-miR-122
  13. Dasypus novemcinctus dno-miR-122-5p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  15. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-122
  17. Gadus morhua gmo-miR-122-5p
  18. Gallus gallus (chicken) Gga-Mir-122-P1_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  21. Gorilla gorilla ggo-miR-122
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  23. Macaca mulatta mml-miR-122a-5p
  24. Maylandia zebra mze-miR-122
  25. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  26. Monopterus albus Mal-Mir-122_5p (mature (guide))
  27. Mus musculus mmu-miR-122-5p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  29. Oreochromis niloticus (Nile tilapia) oni-miR-122
  30. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  32. Pan troglodytes (chimpanzee) ptr-miR-122
  33. Paralichthys olivaceus (Japanese flounder) pol-miR-122-5p
  34. Pongo pygmaeus ppy-miR-122
  35. Pteropus alecto pal-miR-122-5p
  36. Pundamilia nyererei pny-miR-122
  37. Python bivittatus (Burmese python) pbv-miR-122-5p
  38. Rattus norvegicus rno-miR-122-5p
  39. Salmo salar ssa-miR-122-5p
  40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  43. Takifugu rubripes fru-miR-122
  44. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  45. Tor tambroides miR-122
  46. Tursiops truncatus miR-122-5p
  47. Xenopus laevis Xla-Mir-122-P6_5p (mature (guide))
  48. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Publications