Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide)) URS00003380CC_7764

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Bos taurus (domestic cattle) bta-miR-122
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  5. Canis lupus familiaris (dog) cfa-miR-122
  6. Capra hircus (goat) chi-miR-122
  7. Cavia porcellus (domestic guinea pig) cpo-miR-122-5p
  8. Cervus elaphus cel-miR-122
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-122_5p (mature (guide))
  10. Chrysemys picta cpi-miR-122-5p
  11. Columba livia (rock pigeon) cli-miR-122-5p
  12. Danio rerio dre-miR-122
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-122-5p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-122
  16. Gadus morhua (Atlantic cod) gmo-miR-122-5p
  17. Gallus gallus Gga-Mir-122-P1_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  20. Gorilla gorilla (western gorilla) ggo-miR-122
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  22. Homo sapiens (human) hsa-miR-122-5p
  23. Loxodonta africana (African savanna elephant) Laf-Mir-122_5p (mature (guide))
  24. Macaca mulatta (Rhesus monkey) mml-miR-122a-5p
  25. Maylandia zebra mze-miR-122
  26. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  27. Microcebus murinus (gray mouse lemur) Mmr-Mir-122_5p (mature (guide))
  28. Monopterus albus (swamp eel) Mal-Mir-122_5p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-122-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  31. Notamacropus eugenii (tammar wallaby) Neu-Mir-122_5p (mature (guide))
  32. Oreochromis niloticus oni-miR-122
  33. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  34. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  35. Pan troglodytes ptr-miR-122
  36. Paralichthys olivaceus pol-miR-122-5p
  37. Pongo abelii (Sumatran orangutan) Pab-Mir-122_5p (mature (guide))
  38. Pongo pygmaeus ppy-miR-122
  39. Pteropus alecto pal-miR-122-5p
  40. Pundamilia nyererei pny-miR-122
  41. Python bivittatus pbv-miR-122-5p
  42. Rattus norvegicus (Norway rat) rno-miR-122-5p
  43. Salmo salar ssa-miR-122-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  46. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  47. Takifugu rubripes (torafugu) fru-miR-122
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  49. Tor tambroides miR-122
  50. Tursiops truncatus miR-122-5p
  51. Xenopus laevis (African clawed frog) Xla-Mir-122-P6_5p (mature (guide))
  52. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Relationships

Molecular Relationships