Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-122 URS00003380CC_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-122: Cfa-mir-122 is an up-regulated microRNA that can down-regulate epo, leading to anemia symptoms in puppies [PMC9773451]. In a study, four differentially expressed microRNAs, including cfa-mir-122 and cfa-miR-193b, were found to potentially regulate 48 target genes [PMC9773451]. Cfa-mir-122 is considered highly liver-enriched and can serve as a biomarker for liver function [PMC4989286]. Other miRNAs evaluated in the study include cfa-miR-885, cfa-miR-1, cfa-miR-133, cfa-miR-206, cfa-miR-34b/c, and cfa-miR-212 [PMC4989286]. Cfa-mir-122 showed high diagnostic performance for early diagnosis of mild hepatic steatosis in dogs with splenoazygos or splenophrenic groups compared to other biochemical parameters such as ALT [PMC7356535]. In differentiating splenocaval shunts from healthy controls, serum levels of miRNAs including cfa-mir-122 showed high sensitivity and specificity with an AUC of 0.99 [PMC7356535]. CFA mir 122 was significantly upregulated in all CPSS groups compared to the control group with high sensitivity and specificity according to AUC yield in each group [PMC7356535]. In discriminating right or left divisional IHPSS group from the control group, miRNA such as CFA mir 126 showed higher diagnostic performance than cfa-mir-122 [PMC7356535]. Seventeen differentially expressed mature miRNAs, including cfa-mir-122, were validated by qRT-PCR in a miRNA-mRNA interaction network [PMC5844969].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Bos taurus (cattle) bta-miR-122
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  5. Capra hircus chi-miR-122
  6. Cavia porcellus cpo-miR-122-5p
  7. Cervus elaphus (red deer) cel-miR-122
  8. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
  9. Chrysemys picta cpi-miR-122-5p
  10. Columba livia (rock pigeon) cli-miR-122-5p
  11. Danio rerio dre-miR-122
  12. Dasypus novemcinctus dno-miR-122-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-122
  16. Gadus morhua gmo-miR-122-5p
  17. Gallus gallus (chicken) Gga-Mir-122-P1_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  20. Gorilla gorilla ggo-miR-122
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  22. Homo sapiens hsa-miR-122-5p
  23. Macaca mulatta mml-miR-122a-5p
  24. Maylandia zebra mze-miR-122
  25. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  26. Monopterus albus Mal-Mir-122_5p (mature (guide))
  27. Mus musculus mmu-miR-122-5p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  29. Oreochromis niloticus (Nile tilapia) oni-miR-122
  30. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  32. Pan troglodytes (chimpanzee) ptr-miR-122
  33. Paralichthys olivaceus (Japanese flounder) pol-miR-122-5p
  34. Pongo pygmaeus ppy-miR-122
  35. Pteropus alecto pal-miR-122-5p
  36. Pundamilia nyererei pny-miR-122
  37. Python bivittatus (Burmese python) pbv-miR-122-5p
  38. Rattus norvegicus rno-miR-122-5p
  39. Salmo salar ssa-miR-122-5p
  40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  43. Takifugu rubripes fru-miR-122
  44. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  45. Tor tambroides miR-122
  46. Tursiops truncatus miR-122-5p
  47. Xenopus laevis Xla-Mir-122-P6_5p (mature (guide))
  48. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Publications