Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-122 URS00003380CC_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-122: Cfa-mir-122 is a microRNA (miRNA) that is highly enriched in the liver and has been implicated in the regulation of various genes and biological processes in dogs [PMC4989286]. This miRNA has been shown to down-regulate erythropoietin (epo), potentially affecting red blood cell maturation and leading to anemia symptoms in puppies [PMC9773451]. It is one of the differentially expressed miRNAs that can regulate a significant number of potential target genes, indicating its role in gene expression modulation [PMC9773451]. In serum miRNA analysis, cfa-mir-122 has been identified as a potential biomarker for liver function, with its expression levels significantly elevated compared to control animals [PMC4989286]. Furthermore, cfa-mir-122 demonstrates high diagnostic performance for early detection of mild hepatic steatosis, outperforming traditional biochemical parameters like ALT [PMC7356535]. It was the only miRNA significantly upregulated across all examined canine portosystemic shunt (CPSS) groups compared to controls, suggesting its utility as a non-invasive biomarker with high sensitivity and specificity for reflecting liver pathology [PMC7356535]. The diagnostic potential of cfa-mir-122 is further supported by receiver operating characteristic (ROC) curve analysis with an area under the curve (AUC) indicating excellent diagnostic accuracy for differentiating diseased groups from healthy controls [PMC7356535].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Bos taurus (domestic cattle) bta-miR-122
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  5. Capra hircus (goat) chi-miR-122
  6. Cavia porcellus (domestic guinea pig) cpo-miR-122-5p
  7. Cervus elaphus cel-miR-122
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-122_5p (mature (guide))
  9. Chrysemys picta cpi-miR-122-5p
  10. Columba livia (rock pigeon) cli-miR-122-5p
  11. Danio rerio dre-miR-122
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-122-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-122
  16. Gadus morhua (Atlantic cod) gmo-miR-122-5p
  17. Gallus gallus Gga-Mir-122-P1_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  20. Gorilla gorilla (western gorilla) ggo-miR-122
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  22. Homo sapiens (human) hsa-miR-122-5p
  23. Loxodonta africana (African savanna elephant) Laf-Mir-122_5p (mature (guide))
  24. Macaca mulatta (Rhesus monkey) mml-miR-122a-5p
  25. Maylandia zebra mze-miR-122
  26. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  27. Microcebus murinus (gray mouse lemur) Mmr-Mir-122_5p (mature (guide))
  28. Monopterus albus (swamp eel) Mal-Mir-122_5p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-122-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  31. Notamacropus eugenii (tammar wallaby) Neu-Mir-122_5p (mature (guide))
  32. Oreochromis niloticus oni-miR-122
  33. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  34. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  35. Pan troglodytes ptr-miR-122
  36. Paralichthys olivaceus pol-miR-122-5p
  37. Pongo abelii (Sumatran orangutan) Pab-Mir-122_5p (mature (guide))
  38. Pongo pygmaeus ppy-miR-122
  39. Pteropus alecto pal-miR-122-5p
  40. Pundamilia nyererei pny-miR-122
  41. Python bivittatus pbv-miR-122-5p
  42. Rattus norvegicus (Norway rat) rno-miR-122-5p
  43. Salmo salar ssa-miR-122-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  46. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  47. Takifugu rubripes (torafugu) fru-miR-122
  48. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  49. Tor tambroides miR-122
  50. Tursiops truncatus miR-122-5p
  51. Xenopus laevis (African clawed frog) Xla-Mir-122-P6_5p (mature (guide))
  52. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Relationships

Molecular Relationships

Publications