Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-133b URS000032BD73_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-133b: Bta-mir-133b is a miRNA that was found to be up-regulated in OECs from non-pregnant cows compared to pregnant cows [PMC7969882]. Along with bta-mir-133b, five other miRNAs (bta-miR-205, bta-miR-584, bta-miR-551a, bta-miR-1193, and bta-miR-1225-3p) were also up-regulated in OECs from non-pregnant cows [PMC7969882]. These miRNAs were found to be involved in the regulation of 37 selected pathways in OECs [PMC7969882]. Interestingly, the up-regulation of bta-mir-133b and other identified miRNAs in non-pregnant cows was also observed in previous studies that exposed bovine OECs to different hormone levels without the presence of an embryo [PMC7969882]. Additionally, a study using stem-loop RT-qPCR confirmed the differential expression patterns of nine out of 14 miRNAs identified by RNA-seq analysis, including bta-mir-133b [PMC4840452]. Furthermore, the expression of bta-mir-133b was found to be upregulated in an infected compartment compared to a control group [PMC4840452]. Overall, these findings suggest that bta-mir-133b plays a role in regulating gene expression and may be involved in reproductive processes and immune responses.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Canis lupus familiaris cfa-miR-133b
  3. Cavia porcellus (domestic guinea pig) cpo-miR-133b-3p
  4. Chrysemys picta bellii Cpi-Mir-133-P2-v1_3p (mature (guide))
  5. Columba livia (rock pigeon) cli-miR-133b-3p
  6. Danio rerio (zebrafish) dre-miR-133b-3p
  7. Dasypus novemcinctus dno-miR-133b-3p
  8. Echinops telfairi Ete-Mir-133-P2-v1_3p (mature (guide))
  9. Equus caballus eca-miR-133b
  10. Gallus gallus Gga-Mir-133-P2-v1_3p (mature (guide))
  11. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  12. Homo sapiens (human) hsa-miR-133b
  13. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  14. Lepisosteus oculatus Loc-Mir-133-P2-v1_3p (mature (guide))
  15. Macaca mulatta mml-miR-133b-3p
  16. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  17. Monodelphis domestica Mdo-Mir-133-P2-v1_3p (mature (guide))
  18. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-133b-3p
  20. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  21. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  22. Pan troglodytes ptr-miR-133b
  23. Pongo pygmaeus ppy-miR-133b
  24. Python bivittatus pbv-miR-133b-3p
  25. Rattus norvegicus rno-miR-133b-3p
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-133-P2_3p (mature (guide))
  28. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P2-v1_3p (mature (guide))
  29. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  30. Tor tambroides miR-133b-3p
  31. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  32. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
Publications