Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monopterus albus (swamp eel) Mal-Mir-133-P2a-v1_3p (mature (guide)) URS000032BD73_43700

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Bos taurus (cattle) bta-miR-133b
  3. Canis lupus familiaris cfa-miR-133b
  4. Cavia porcellus (domestic guinea pig) cpo-miR-133b-3p
  5. Chrysemys picta bellii Cpi-Mir-133-P2-v1_3p (mature (guide))
  6. Columba livia (rock pigeon) cli-miR-133b-3p
  7. Danio rerio (zebrafish) dre-miR-133b-3p
  8. Dasypus novemcinctus dno-miR-133b-3p
  9. Echinops telfairi Ete-Mir-133-P2-v1_3p (mature (guide))
  10. Equus caballus eca-miR-133b
  11. Gallus gallus Gga-Mir-133-P2-v1_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  13. Homo sapiens (human) hsa-miR-133b
  14. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  15. Lepisosteus oculatus Loc-Mir-133-P2-v1_3p (mature (guide))
  16. Macaca mulatta mml-miR-133b-3p
  17. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  18. Monodelphis domestica Mdo-Mir-133-P2-v1_3p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-133b-3p
  20. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  21. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  22. Pan troglodytes ptr-miR-133b
  23. Pongo pygmaeus ppy-miR-133b
  24. Python bivittatus pbv-miR-133b-3p
  25. Rattus norvegicus rno-miR-133b-3p
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-133-P2_3p (mature (guide))
  28. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P2-v1_3p (mature (guide))
  29. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  30. Tor tambroides miR-133b-3p
  31. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  32. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))