Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sphenodon punctatus (tuatara) Spt-Mir-133-P2_3p (mature (guide)) secondary structure diagram

Sphenodon punctatus (tuatara) Spt-Mir-133-P2_3p (mature (guide)) URS000032BD73_8508

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Bos taurus (domestic cattle) bta-miR-133b
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-133-P2_3p (mature (guide))
  4. Canis lupus familiaris (dog) cfa-miR-133b
  5. Cavia porcellus cpo-miR-133b-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v1_3p (mature (guide))
  7. Columba livia cli-miR-133b-3p
  8. Danio rerio (zebrafish) dre-miR-133b-3p
  9. Dasypus novemcinctus dno-miR-133b-3p
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v1_3p (mature (guide))
  11. Equus caballus eca-miR-133b
  12. Gallus gallus (chicken) Gga-Mir-133-P2-v1_3p (mature (guide))
  13. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  14. Homo sapiens (human) hsa-miR-133b
  15. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v1_3p (mature (guide))
  17. Loxodonta africana (African savanna elephant) Laf-Mir-133-P2_3p (mature (guide))
  18. Macaca mulatta mml-miR-133b-3p
  19. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  20. Microcebus murinus (gray mouse lemur) Mmr-Mir-133-P2-v1_3p (mature (guide))
  21. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-133-P2-v1_3p (mature (guide))
  22. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  23. Mus musculus mmu-miR-133b-3p
  24. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  25. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  26. Pan troglodytes ptr-miR-133b
  27. Pongo abelii (Sumatran orangutan) Pab-Mir-133-P2_3p (mature (guide))
  28. Pongo pygmaeus (Bornean orangutan) ppy-miR-133b
  29. Python bivittatus pbv-miR-133b-3p
  30. Rattus norvegicus rno-miR-133b-3p
  31. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-133-P2-v1_3p (mature (guide))
  33. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-133b-3p
  35. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
Relationships

Molecular Relationships

2D structure

Loading 2D structure...