v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) hsa-miR-133b secondary structure diagram

Homo sapiens (human) hsa-miR-133b URS000032BD73_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-133b: Hsa-mir-133b is a microRNA that has been identified as deexpressed in tumor tissues when compared to normal tissues, indicating a potential role in cancer biology [PMC4436811]. This microRNA, along with others such as hsa-miR-137 and hsa-miR-133a, showed a significant decrease in expression levels in tumor samples, with an adjusted P-value of 0.05 [PMC4436811]. Furthermore, hsa-mir-133b is also found to have decreased expression in muscle-related diseases such as polymyositis/dermatomyositis (PM/DM) and inclusion body myositis (IBM), suggesting its involvement in muscle pathology [PMC5757292]. This pattern of downregulation across different disease states could imply that hsa-mir-133b has a role in the normal functioning of tissues and that its reduced expression may contribute to disease processes [PMC5757292].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Bos taurus (domestic cattle) bta-miR-133b
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-133-P2_3p (mature (guide))
  4. Canis lupus familiaris (dog) cfa-miR-133b
  5. Cavia porcellus cpo-miR-133b-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v1_3p (mature (guide))
  7. Columba livia cli-miR-133b-3p
  8. Danio rerio (zebrafish) dre-miR-133b-3p
  9. Dasypus novemcinctus dno-miR-133b-3p
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v1_3p (mature (guide))
  11. Equus caballus eca-miR-133b
  12. Gallus gallus (chicken) Gga-Mir-133-P2-v1_3p (mature (guide))
  13. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  14. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  15. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v1_3p (mature (guide))
  16. Loxodonta africana (African savanna elephant) Laf-Mir-133-P2_3p (mature (guide))
  17. Macaca mulatta mml-miR-133b-3p
  18. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  19. Microcebus murinus (gray mouse lemur) Mmr-Mir-133-P2-v1_3p (mature (guide))
  20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-133-P2-v1_3p (mature (guide))
  21. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  22. Mus musculus mmu-miR-133b-3p
  23. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  24. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  25. Pan troglodytes ptr-miR-133b
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-133-P2_3p (mature (guide))
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-133b
  28. Python bivittatus pbv-miR-133b-3p
  29. Rattus norvegicus rno-miR-133b-3p
  30. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-133-P2_3p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-133-P2-v1_3p (mature (guide))
  33. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-133b-3p
  35. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 GoFlow Results Publications