v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v1_3p (mature (guide)) secondary structure diagram

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v1_3p (mature (guide)) URS000032BD73_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Bos taurus (domestic cattle) bta-miR-133b
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-133-P2_3p (mature (guide))
  4. Canis lupus familiaris (dog) cfa-miR-133b
  5. Cavia porcellus cpo-miR-133b-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v1_3p (mature (guide))
  7. Columba livia cli-miR-133b-3p
  8. Danio rerio (zebrafish) dre-miR-133b-3p
  9. Dasypus novemcinctus dno-miR-133b-3p
  10. Equus caballus eca-miR-133b
  11. Gallus gallus (chicken) Gga-Mir-133-P2-v1_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  13. Homo sapiens (human) hsa-miR-133b
  14. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  15. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v1_3p (mature (guide))
  16. Loxodonta africana (African savanna elephant) Laf-Mir-133-P2_3p (mature (guide))
  17. Macaca mulatta mml-miR-133b-3p
  18. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  19. Microcebus murinus (gray mouse lemur) Mmr-Mir-133-P2-v1_3p (mature (guide))
  20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-133-P2-v1_3p (mature (guide))
  21. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  22. Mus musculus mmu-miR-133b-3p
  23. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  24. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  25. Pan troglodytes ptr-miR-133b
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-133-P2_3p (mature (guide))
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-133b
  28. Python bivittatus pbv-miR-133b-3p
  29. Rattus norvegicus rno-miR-133b-3p
  30. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-133-P2_3p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-133-P2-v1_3p (mature (guide))
  33. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-133b-3p
  35. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...