v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-133b URS000032BD73_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-133b: Hsa-mir-133b is a microRNA that is downregulated in tumors compared to normal tissues [PMC4436811]. In addition to hsa-mir-133b, several other microRNAs, including hsa-miR-137, hsa-miR-133a, hsa-miR-143, hsa-miR-363, hsa-miR-4770, and hsa-miR-490-5p, were also found to be downregulated in tumors [PMC4436811]. This downregulation of microRNAs in tumors suggests their potential role as tumor suppressors. Furthermore, a study found that the expression of hsa-mir-133b and other microRNAs such as hsa-mir-1 and hsa-mir-133a was decreased in patients with polymyositis/dermatomyositis (PM/DM) and inclusion body myositis (IBM) [PMC5757292]. Additionally, the expression of miR-206 was decreased in patients with DM [PMC5757292]. These findings suggest that the downregulation of these microRNAs may be associated with the development or progression of PM/DM and DM. Further research is needed to elucidate the specific roles of these microRNAs in tumor development and muscle diseases.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Bos taurus (cattle) bta-miR-133b
  3. Canis lupus familiaris cfa-miR-133b
  4. Cavia porcellus (domestic guinea pig) cpo-miR-133b-3p
  5. Chrysemys picta bellii Cpi-Mir-133-P2-v1_3p (mature (guide))
  6. Columba livia (rock pigeon) cli-miR-133b-3p
  7. Danio rerio (zebrafish) dre-miR-133b-3p
  8. Dasypus novemcinctus dno-miR-133b-3p
  9. Echinops telfairi Ete-Mir-133-P2-v1_3p (mature (guide))
  10. Equus caballus eca-miR-133b
  11. Gallus gallus Gga-Mir-133-P2-v1_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  13. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  14. Lepisosteus oculatus Loc-Mir-133-P2-v1_3p (mature (guide))
  15. Macaca mulatta mml-miR-133b-3p
  16. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  17. Monodelphis domestica Mdo-Mir-133-P2-v1_3p (mature (guide))
  18. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-133b-3p
  20. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  21. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  22. Pan troglodytes ptr-miR-133b
  23. Pongo pygmaeus ppy-miR-133b
  24. Python bivittatus pbv-miR-133b-3p
  25. Rattus norvegicus rno-miR-133b-3p
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-133-P2_3p (mature (guide))
  28. Taeniopygia guttata (zebra finch) Tgu-Mir-133-P2-v1_3p (mature (guide))
  29. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  30. Tor tambroides miR-133b-3p
  31. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  32. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
 Publications