Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (domestic cattle) bta-miR-133b secondary structure diagram

Bos taurus (domestic cattle) bta-miR-133b URS000032BD73_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-133b: bta-mir-133b is a microRNA (miRNA) that was identified as one of the six miRNAs up-regulated in the oviductal epithelial cells (OECs) of non-pregnant cows, with no up-regulation observed in the OECs of pregnant cows [PMC7969882]. This miRNA, along with others, is predicted to regulate 37 biological pathways in OECs from non-pregnant cows when compared to pregnant ones [PMC7969882]. Despite being up-regulated in non-pregnant cows, bta-mir-133b was previously detected in bovine OECs under varying levels of estrogen (E2) and progesterone (P4), but without significant differences in expression levels when an embryo was not present [PMC7969882]. bta-mir-133b is also listed among the top 20 most abundant miRNAs across all developmental stages [PMC7073773], and its differential expression pattern has been confirmed by stem-loop RT-qPCR, reinforcing its significance as revealed by RNA-Seq [PMC4840452]. Additionally, bta-mir-133b expression was found to be upregulated in an infected compartment compared to a control group, indicating its potential involvement in response to infection [PMC4840452].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUCCCCUUCAACCAGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Alligator mississippiensis (American alligator) ami-miR-133b-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-133-P2_3p (mature (guide))
  3. Canis lupus familiaris (dog) cfa-miR-133b
  4. Cavia porcellus cpo-miR-133b-3p
  5. Chrysemys picta bellii (western painted turtle) Cpi-Mir-133-P2-v1_3p (mature (guide))
  6. Columba livia cli-miR-133b-3p
  7. Danio rerio (zebrafish) dre-miR-133b-3p
  8. Dasypus novemcinctus dno-miR-133b-3p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-133-P2-v1_3p (mature (guide))
  10. Equus caballus eca-miR-133b
  11. Gallus gallus (chicken) Gga-Mir-133-P2-v1_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-133-P2-v1_3p (mature (guide))
  13. Homo sapiens (human) hsa-miR-133b
  14. Latimeria chalumnae Lch-Mir-133-P2_3p (mature (guide))
  15. Lepisosteus oculatus (spotted gar) Loc-Mir-133-P2-v1_3p (mature (guide))
  16. Loxodonta africana (African savanna elephant) Laf-Mir-133-P2_3p (mature (guide))
  17. Macaca mulatta mml-miR-133b-3p
  18. Microcaecilia unicolor Mun-Mir-133-P2-v1_3p (mature (guide))
  19. Microcebus murinus (gray mouse lemur) Mmr-Mir-133-P2-v1_3p (mature (guide))
  20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-133-P2-v1_3p (mature (guide))
  21. Monopterus albus Mal-Mir-133-P2a-v1_3p (mature (guide))
  22. Mus musculus mmu-miR-133b-3p
  23. Ornithorhynchus anatinus (platypus) oan-miR-133b-3p
  24. Oryctolagus cuniculus (rabbit) ocu-miR-133b-3p
  25. Pan troglodytes ptr-miR-133b
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-133-P2_3p (mature (guide))
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-133b
  28. Python bivittatus pbv-miR-133b-3p
  29. Rattus norvegicus rno-miR-133b-3p
  30. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-133-P2-v1_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-133-P2_3p (mature (guide))
  32. Taeniopygia guttata Tgu-Mir-133-P2-v1_3p (mature (guide))
  33. Tetraodon nigroviridis Tni-Mir-133-P2a-v1_3p (mature (guide))
  34. Tor tambroides (Thai mahseer) miR-133b-3p
  35. Xenopus laevis Xla-Mir-133-P2c-v1_3p (mature (guide))
  36. Xenopus tropicalis Xtr-Mir-133-P2-v1_3p (mature (guide))
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications