Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-34a-5p URS000030BD69_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (IntAct, miRBase, MalaCards, GeneCards, RefSeq, LncBase, TarBase, ENA, MirGeneDB). Described in 107 papers. Homo sapiens (human) hsa-miR-34a-5p sequence is a product of miR-34a, hsa-miR-34a-5p, miR-34a-5p, miR-34, hsa-miR-34a, MIR34A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F6, 12CC4, 133K02, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 16.3A5, 16E1BP, 17-1A.

Interactions 4

According to IntAct, Homo sapiens (human) hsa-miR-34a-5p interacts with:

IntAct ID Participant Synonyms
EBI-11709632 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-11785307 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-20558741 intact:EBI-20558675 EBI-20558675 ENST00000212015.10 mrna_sirt1
EBI-25434056 intact:EBI-25434059 EBI-25434059 ENST00000370060 mrna_l1cam

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGCAGUGUCUUAGCUGGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Anolis carolinensis Aca-Mir-34-P1_5p (mature (guide))
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-34a
    3. Bos taurus bta-miR-34a
    4. Callorhinchus milii (elephant shark) eshark_mir-34_3
    5. Canis lupus familiaris cfa-miR-34a
    6. Capra hircus chi-miR-34a
    7. Cavia porcellus (domestic guinea pig) cpo-miR-34a-5p
    8. Chiloscyllium plagiosum microRNA cpl-miR-34a
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-34-P1_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-34a-5p
    11. Columba livia cli-miR-34a-5p
    12. Cricetulus griseus cgr-miR-34a
    13. Cyprinus carpio (common carp) ccr-miR-34
    14. Danio rerio (zebrafish) dre-miR-34a
    15. Dasypus novemcinctus dno-miR-34a-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-34-P1_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-34a
    18. Gadus morhua gmo-miR-34-5p
    19. Gallus gallus (chicken) Gga-Mir-34-P1_5p (mature (guide))
    20. Gorilla gorilla (western gorilla) ggo-miR-34a
    21. Haplochromis burtoni abu-miR-34
    22. Ictalurus punctatus (channel catfish) ipu-miR-34a
    23. Lagothrix lagotricha lla-miR-34a
    24. Macaca mulatta mml-miR-34a-5p
    25. Macaca nemestrina (pig-tailed macaque) mne-miR-34a
    26. Maylandia zebra mze-miR-34
    27. Microcebus murinus mmr-miR-34a
    28. Mus musculus (house mouse) mmu-miR-34a-5p
    29. Neolamprologus brichardi nbr-miR-34
    30. Nomascus leucogenys nle-miR-34a
    31. Oreochromis niloticus oni-miR-34
    32. Oryctolagus cuniculus (rabbit) ocu-miR-34a-5p
    33. Otolemur garnettii oga-miR-34a
    34. Pan paniscus ppa-miR-34a
    35. Pan troglodytes (chimpanzee) ptr-miR-34a
    36. Pongo pygmaeus ppy-miR-34a
    37. Pteropus alecto pal-miR-34a-5p
    38. Pundamilia nyererei pny-miR-34
    39. Python bivittatus pbv-miR-34a-5p
    40. Rattus norvegicus rno-miR-34a-5p
    41. Saguinus labiatus sla-miR-34a
    42. Sus scrofa (pig) ssc-miR-34a
    43. synthetic construct miscellaneous RNA
    44. Taeniopygia guttata (zebra finch) tgu-miR-34a
    45. Tor tambroides miR-34a
    46. Xenopus laevis xla-miR-34a
    47. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4079397