Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-34 URS000030BD69_106582

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUCUUAGCUGGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Ateles geoffroyi age-miR-34a
  2. Bos taurus (cattle) bta-miR-34a
  3. Callorhinchus milii (elephant shark) eshark_mir-34_3
  4. Canis lupus familiaris cfa-miR-34a
  5. Capra hircus chi-miR-34a
  6. Cavia porcellus cpo-miR-34a-5p
  7. Chiloscyllium plagiosum microRNA cpl-miR-34a
  8. Chrysemys picta cpi-miR-34a-5p
  9. Columba livia (rock pigeon) cli-miR-34a-5p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-34a
  11. Cyprinus carpio (common carp) ccr-miR-34
  12. Danio rerio dre-miR-34a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34a-5p
  14. Equus caballus eca-miR-34a
  15. Gadus morhua gmo-miR-34-5p
  16. Gorilla gorilla gorilla ggo-miR-34a (MIR34A)
  17. Gorilla gorilla ggo-miR-34a
  18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-34
  19. Homo sapiens hsa-miR-34a-5p
  20. Ictalurus punctatus (channel catfish) ipu-miR-34a
  21. Lagothrix lagotricha lla-miR-34a
  22. Macaca mulatta (Rhesus monkey) mml-miR-34a-5p
  23. Macaca nemestrina (pig-tailed macaque) mne-miR-34a
  24. Microcebus murinus (gray mouse lemur) mmr-miR-34a
  25. Mus musculus mmu-miR-34a-5p
  26. Neolamprologus brichardi (lyretail cichlid) nbr-miR-34
  27. Nomascus leucogenys nle-miR-34a
  28. Oreochromis niloticus (Nile tilapia) oni-miR-34
  29. Oryctolagus cuniculus (rabbit) ocu-miR-34a-5p
  30. Otolemur garnettii oga-miR-34a
  31. Pan paniscus ppa-miR-34a
  32. Pan troglodytes ptr-miR-34a
  33. Pongo pygmaeus (Bornean orangutan) ppy-miR-34a
  34. Pteropus alecto pal-miR-34a-5p
  35. Pundamilia nyererei pny-miR-34
  36. Python bivittatus (Burmese python) pbv-miR-34a-5p
  37. Rattus norvegicus (Norway rat) rno-miR-34a-5p
  38. Saguinus labiatus (red-chested mustached tamarin) sla-miR-34a
  39. Sus scrofa (pig) ssc-miR-34a
  40. synthetic construct miscellaneous RNA
  41. Taeniopygia guttata (zebra finch) tgu-miR-34a
  42. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-34-P1_5p (mature (guide))
  43. Tor tambroides miR-34a
  44. Xenopus laevis (African clawed frog) xla-miR-34a
  45. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4079397