Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-34a-5p URS000030BD69_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-34a: Rno-mir-34a is a type of microRNA that has been found to be significantly up-regulated in the small intestine of rats after heat treatment, suggesting its involvement in heat stress-induced apoptosis of the intestinal epithelium [PMC7699918]. A binding sites overrepresentation analysis revealed that rno-mir-34a binding sites were significantly enriched within up-regulated genes, further supporting its role in regulating gene expression [PMC3542345]. Rno-mir-34a has also been identified as a potential early marker for predicting carcinogenic potential [PMC4022579]. In addition, rno-mir-34a has been found to target differentially expressed mRNAs and regulate the expression of ECM proteins, such as type I collagen and alpha smooth muscle actin (α-SMA) [PMC4601392]. Silencing rno-mir-34a expression resulted in increased ACSL1 mRNA and protein expression, indicating that ACSL1 is a target gene of rno-mir-34a [PMC4601392]. Rno-mir-34a upregulation and ACSL1 downregulation have also been associated with the activation of primary hepatic stellate cells (HSCs) [PMC4601392]. Furthermore, a luciferase reporter assay confirmed that rno-mir-34a directly binds to the 3'-UTR of ACSL1 mRNA [PMC4601392]. Abnormal expression of rno-miR-34a has also been linked to cancer and myocardial ischemia-reperfusion injury in rats [PMC7290437] [PMC7238603]. Overall, these findings highlight the role of rno-miR-34a in various biological processes and its potential as a therapeutic target.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUCUUAGCUGGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Ateles geoffroyi age-miR-34a
  2. Bos taurus (cattle) bta-miR-34a
  3. Callorhinchus milii (elephant shark) eshark_mir-34_3
  4. Canis lupus familiaris cfa-miR-34a
  5. Capra hircus chi-miR-34a
  6. Cavia porcellus cpo-miR-34a-5p
  7. Chiloscyllium plagiosum microRNA cpl-miR-34a
  8. Chrysemys picta cpi-miR-34a-5p
  9. Columba livia (rock pigeon) cli-miR-34a-5p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-34a
  11. Cyprinus carpio (common carp) ccr-miR-34
  12. Danio rerio dre-miR-34a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34a-5p
  14. Equus caballus eca-miR-34a
  15. Gadus morhua gmo-miR-34-5p
  16. Gorilla gorilla gorilla ggo-miR-34a (MIR34A)
  17. Gorilla gorilla ggo-miR-34a
  18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-34
  19. Homo sapiens hsa-miR-34a-5p
  20. Ictalurus punctatus (channel catfish) ipu-miR-34a
  21. Lagothrix lagotricha lla-miR-34a
  22. Macaca mulatta (Rhesus monkey) mml-miR-34a-5p
  23. Macaca nemestrina (pig-tailed macaque) mne-miR-34a
  24. Maylandia zebra mze-miR-34
  25. Microcebus murinus (gray mouse lemur) mmr-miR-34a
  26. Mus musculus mmu-miR-34a-5p
  27. Neolamprologus brichardi (lyretail cichlid) nbr-miR-34
  28. Nomascus leucogenys nle-miR-34a
  29. Oreochromis niloticus (Nile tilapia) oni-miR-34
  30. Oryctolagus cuniculus (rabbit) ocu-miR-34a-5p
  31. Otolemur garnettii oga-miR-34a
  32. Pan paniscus ppa-miR-34a
  33. Pan troglodytes ptr-miR-34a
  34. Pongo pygmaeus (Bornean orangutan) ppy-miR-34a
  35. Pteropus alecto pal-miR-34a-5p
  36. Pundamilia nyererei pny-miR-34
  37. Python bivittatus (Burmese python) pbv-miR-34a-5p
  38. Saguinus labiatus (red-chested mustached tamarin) sla-miR-34a
  39. Sus scrofa (pig) ssc-miR-34a
  40. synthetic construct miscellaneous RNA
  41. Taeniopygia guttata (zebra finch) tgu-miR-34a
  42. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-34-P1_5p (mature (guide))
  43. Tor tambroides miR-34a
  44. Xenopus laevis (African clawed frog) xla-miR-34a
  45. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4079397
Publications