Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-34a URS000030BD69_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-34a: Ssc-mir-34a is an endogenous control that has been confirmed to be stably expressed in peripheral blood mononuclear cells (PBMC) [PMC5085634]. It has been predicted to have target sites in SLA-1 and HSPA1A, as well as disrupted target sites in RNF5 and SLA-1 [PMC3490867]. In a study on the expression profile of novel miRNAs in pig tissues, ssc-mir-34a was found to be mainly expressed in the lungs [PMC3427155]. It has also been identified as one of the miRNAs that potentially binds to circ_2141, along with ssc-miR-133a-5p, ssc-miR-138, and ssc-miR-7137-3p [PMC9219244]. Furthermore, a down-regulated circRNA called "circ 11:4104218-4118265" was found to interact with FSTL4 via ssc-mir-34a [PMC7827264]. Ssc-mir-34a is also listed as one of the miRBase identifiers for various species including humans (hsa-miR-34a), mice (mmu-miR-34a), rats (rno-miR-34a), and pigs (ssc-mir-34a) [PMC5085156]. The primers for amplifying miRNAs include a specific forward primer for ssc-mir 34-a [PMC4908419]. In summary, ssc-mir 34-a is an endogenous control that is stably expressed in PBMCs and has predicted target sites in various genes. It is mainly expressed in the lungs and potentially interacts with circ_2141.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUCUUAGCUGGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Ateles geoffroyi age-miR-34a
  2. Bos taurus (cattle) bta-miR-34a
  3. Callorhinchus milii (elephant shark) eshark_mir-34_3
  4. Canis lupus familiaris cfa-miR-34a
  5. Capra hircus chi-miR-34a
  6. Cavia porcellus cpo-miR-34a-5p
  7. Chiloscyllium plagiosum microRNA cpl-miR-34a
  8. Chrysemys picta cpi-miR-34a-5p
  9. Columba livia (rock pigeon) cli-miR-34a-5p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-34a
  11. Cyprinus carpio (common carp) ccr-miR-34
  12. Danio rerio dre-miR-34a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34a-5p
  14. Equus caballus eca-miR-34a
  15. Gadus morhua gmo-miR-34-5p
  16. Gorilla gorilla gorilla ggo-miR-34a (MIR34A)
  17. Gorilla gorilla ggo-miR-34a
  18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-34
  19. Homo sapiens hsa-miR-34a-5p
  20. Ictalurus punctatus (channel catfish) ipu-miR-34a
  21. Lagothrix lagotricha lla-miR-34a
  22. Macaca mulatta (Rhesus monkey) mml-miR-34a-5p
  23. Macaca nemestrina (pig-tailed macaque) mne-miR-34a
  24. Maylandia zebra mze-miR-34
  25. Microcebus murinus (gray mouse lemur) mmr-miR-34a
  26. Mus musculus mmu-miR-34a-5p
  27. Neolamprologus brichardi (lyretail cichlid) nbr-miR-34
  28. Nomascus leucogenys nle-miR-34a
  29. Oreochromis niloticus (Nile tilapia) oni-miR-34
  30. Oryctolagus cuniculus (rabbit) ocu-miR-34a-5p
  31. Otolemur garnettii oga-miR-34a
  32. Pan paniscus ppa-miR-34a
  33. Pan troglodytes ptr-miR-34a
  34. Pongo pygmaeus (Bornean orangutan) ppy-miR-34a
  35. Pteropus alecto pal-miR-34a-5p
  36. Pundamilia nyererei pny-miR-34
  37. Python bivittatus (Burmese python) pbv-miR-34a-5p
  38. Rattus norvegicus (Norway rat) rno-miR-34a-5p
  39. Saguinus labiatus (red-chested mustached tamarin) sla-miR-34a
  40. synthetic construct miscellaneous RNA
  41. Taeniopygia guttata (zebra finch) tgu-miR-34a
  42. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-34-P1_5p (mature (guide))
  43. Tor tambroides miR-34a
  44. Xenopus laevis (African clawed frog) xla-miR-34a
  45. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4079397
Publications