Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29c-3p URS0000272A3D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-29c: Hsa-mir-29c is a microRNA that is predicted to have a terminal loop with a size of 5 nt [PMC4072616]. It is one of the key microRNAs involved in regulating hepatocyte immune response, inflammatory response, and glutathione metabolism [PMC4121398]. Additionally, hsa-mir-29c has been identified as a promising diagnostic and prognostic marker in the clinic [PMC7100107]. In a comparison between expression in AEM and advanced carcinoma, hsa-mir-29c was found to be statistically significant [PMC7764749]. Overall, hsa-mir-29c plays an important role in various biological processes and has potential clinical applications as a diagnostic and prognostic marker. Its predicted terminal loop size distinguishes it from other microRNAs such as hsa-let-7 g, hsa-mir-7-1, and hsa-mir-9-2 which have smaller terminal loops [PMC4072616]. In microRNA-gene networks, hsa-mir-29c is among the key microRNAs that negatively regulate downstream target genes involved in hepatocyte immune response, inflammatory response, and glutathione metabolism [PMC4121398]. Its significance as a diagnostic marker is further supported by its inclusion among nine miRNAs proven to be promising markers in clinical settings [PMC7100107]. In conclusion, the role of hsa-mir-29c extends beyond its predicted secondary structure. Its involvement in various biological processes makes it an important target for further research and potential clinical applications.

mRNA interactions 39 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-29a-3p
  2. Anolis carolinensis Aca-Mir-29-P2b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29c
  4. Bos taurus bta-miR-29c
  5. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2b_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-29c
  7. Cavia porcellus cpo-miR-29c-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-29a
  9. Chrysemys picta bellii Cpi-Mir-29-P2b_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-29a-3p
  11. Columba livia (rock pigeon) cli-miR-29a-3p
  12. Cyprinus carpio ccr-miR-29a
  13. Danio rerio dre-miR-29a
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29c-3p
  15. Echinops telfairi Ete-Mir-29-P2d_3p (mature (guide))
  16. Eptatretus burgeri Ebu-Mir-29-P2f_3p (mature (guide))
  17. Equus caballus eca-miR-29c
  18. Gadus morhua gmo-miR-29a-3p
  19. Gallus gallus Gga-Mir-29-P2b_3p (mature (guide))
  20. Gekko japonicus Gja-Mir-29-P2b_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-29c (MIR29C)
  22. Gorilla gorilla ggo-miR-29c
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29a
  24. Latimeria chalumnae Lch-Mir-29-P2b_3p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P2d-v1_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-29c-3p
  27. Maylandia zebra (zebra mbuna) mze-miR-29a
  28. Microcaecilia unicolor Mun-Mir-29-P2b_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-29-P2b_3p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-29-P2b1-v1_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-29c-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29a
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29c
  34. Ophiophagus hannah (king cobra) oha-miR-29a-3p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-29a
  36. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b_3p (mature (guide))
  37. Oryctolagus cuniculus ocu-miR-29c-3p
  38. Pan troglodytes ptr-miR-29c
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-29c
  40. Pteropus alecto pal-miR-29c-3p
  41. Pundamilia nyererei pny-miR-29a
  42. Python bivittatus Pbv-Mir-29-P2b_3p (mature (co-guide))
  43. Rattus norvegicus rno-miR-29c-3p
  44. Salmo salar (Atlantic salmon) ssa-miR-29b-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b_3p (mature (guide))
  46. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-29-P2b_3p (mature (guide))
  48. Sus scrofa ssc-miR-29c
  49. Taeniopygia guttata Tgu-Mir-29-P2b_3p (mature (guide))
  50. Takifugu rubripes fru-miR-29a
  51. Tetraodon nigroviridis tni-miR-29a
  52. Tor tambroides (Thai mahseer) miR-29a
  53. Xenopus laevis (African clawed frog) xla-miR-29c-3p
  54. Xenopus tropicalis Xtr-Mir-29-P2b_3p (mature (guide))
Publications