Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) cli-miR-29a-3p URS0000272A3D_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-29a-3p
  2. Anolis carolinensis Aca-Mir-29-P2b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29c
  4. Bos taurus bta-miR-29c
  5. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2b_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-29c
  7. Cavia porcellus cpo-miR-29c-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-29a
  9. Chrysemys picta bellii Cpi-Mir-29-P2b_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-29a-3p
  11. Cyprinus carpio ccr-miR-29a
  12. Danio rerio dre-miR-29a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29c-3p
  14. Echinops telfairi Ete-Mir-29-P2d_3p (mature (guide))
  15. Eptatretus burgeri Ebu-Mir-29-P2f_3p (mature (guide))
  16. Equus caballus eca-miR-29c
  17. Gadus morhua gmo-miR-29a-3p
  18. Gallus gallus Gga-Mir-29-P2b_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-29-P2b_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-29c (MIR29C)
  21. Gorilla gorilla ggo-miR-29c
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29a
  23. Homo sapiens hsa-miR-29c-3p
  24. Latimeria chalumnae Lch-Mir-29-P2b_3p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P2d-v1_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-29c-3p
  27. Maylandia zebra (zebra mbuna) mze-miR-29a
  28. Microcaecilia unicolor Mun-Mir-29-P2b_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-29-P2b_3p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-29-P2b1-v1_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-29c-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29a
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29c
  34. Ophiophagus hannah (king cobra) oha-miR-29a-3p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-29a
  36. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b_3p (mature (guide))
  37. Oryctolagus cuniculus ocu-miR-29c-3p
  38. Pan troglodytes ptr-miR-29c
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-29c
  40. Pteropus alecto pal-miR-29c-3p
  41. Pundamilia nyererei pny-miR-29a
  42. Python bivittatus Pbv-Mir-29-P2b_3p (mature (co-guide))
  43. Rattus norvegicus rno-miR-29c-3p
  44. Salmo salar (Atlantic salmon) ssa-miR-29b-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b_3p (mature (guide))
  46. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-29-P2b_3p (mature (guide))
  48. Sus scrofa ssc-miR-29c
  49. Taeniopygia guttata Tgu-Mir-29-P2b_3p (mature (guide))
  50. Takifugu rubripes fru-miR-29a
  51. Tetraodon nigroviridis tni-miR-29a
  52. Tor tambroides (Thai mahseer) miR-29a
  53. Xenopus laevis (African clawed frog) xla-miR-29c-3p
  54. Xenopus tropicalis Xtr-Mir-29-P2b_3p (mature (guide))