Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-29c-3p URS0000272A3D_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-29c: Rno-mir-29c is a microRNA that is down-regulated in various conditions and has been found to play a role in different biological processes. It has been shown to target DNMT3a and is one of only two microRNAs that target this gene [PMC3596316]. Rno-mir-29c is a member of the miR-29 family, which also includes miR-29a and miR-29b [PMC3895276]. The expression levels of rno-mir-29c have been found to be reduced in the mature rat cochleae [PMC4172914]. Rno-mir-29c has been shown to regulate the expression of various genes, including Period Circadian Regulator 3 (Per3) and Proprotein Convertase Subtilisin/Kexin Type 9 (Pcsk9) [PMC8226960]. Down-regulation of rno-mir-29c has also been associated with enhanced fibrotic response and progression towards heart failure [PMC6377737]. Rno-mir-29c has been found to target members of the DNAJ heat shock protein family (Hsp40) [PMC6377737]. Fish oil supplementation has been shown to alter the expression of rno-mir-29c, as well as other miRNAs, in Sprague Dawley rats with non-alcoholic fatty liver disease (NAFLD) [PMC6321427]. Fish oil feeding can reduce the expression of rno-mir-29c and increase the expression of other miRNAs, such as rno-miR-328 and rno-miR30d, which can regulate genes associated with circadian rhythm, cholesterol metabolism, and liver inflammation [PMC5485288]. Additionally, rno-miR-29a, rno-miR- 29b, and rno-mir-29c have been predicted to regulate the expression of genes involved in bone formation [PMC3273934].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-29a-3p
  2. Anolis carolinensis Aca-Mir-29-P2b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29c
  4. Bos taurus bta-miR-29c
  5. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2b_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-29c
  7. Cavia porcellus cpo-miR-29c-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-29a
  9. Chrysemys picta bellii Cpi-Mir-29-P2b_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-29a-3p
  11. Columba livia (rock pigeon) cli-miR-29a-3p
  12. Cyprinus carpio ccr-miR-29a
  13. Danio rerio dre-miR-29a
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29c-3p
  15. Echinops telfairi Ete-Mir-29-P2d_3p (mature (guide))
  16. Eptatretus burgeri Ebu-Mir-29-P2f_3p (mature (guide))
  17. Equus caballus eca-miR-29c
  18. Gadus morhua gmo-miR-29a-3p
  19. Gallus gallus Gga-Mir-29-P2b_3p (mature (guide))
  20. Gekko japonicus Gja-Mir-29-P2b_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-29c (MIR29C)
  22. Gorilla gorilla ggo-miR-29c
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29a
  24. Homo sapiens hsa-miR-29c-3p
  25. Latimeria chalumnae Lch-Mir-29-P2b_3p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P2d-v1_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-29c-3p
  28. Maylandia zebra (zebra mbuna) mze-miR-29a
  29. Microcaecilia unicolor Mun-Mir-29-P2b_3p (mature (guide))
  30. Monodelphis domestica Mdo-Mir-29-P2b_3p (mature (guide))
  31. Monopterus albus (swamp eel) Mal-Mir-29-P2b1-v1_3p (mature (guide))
  32. Mus musculus (house mouse) mmu-miR-29c-3p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29a
  34. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29c
  35. Ophiophagus hannah (king cobra) oha-miR-29a-3p
  36. Oreochromis niloticus (Nile tilapia) oni-miR-29a
  37. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b_3p (mature (guide))
  38. Oryctolagus cuniculus ocu-miR-29c-3p
  39. Pan troglodytes ptr-miR-29c
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-29c
  41. Pteropus alecto pal-miR-29c-3p
  42. Pundamilia nyererei pny-miR-29a
  43. Python bivittatus Pbv-Mir-29-P2b_3p (mature (co-guide))
  44. Salmo salar (Atlantic salmon) ssa-miR-29b-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b_3p (mature (guide))
  46. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-29-P2b_3p (mature (guide))
  48. Sus scrofa ssc-miR-29c
  49. Taeniopygia guttata Tgu-Mir-29-P2b_3p (mature (guide))
  50. Takifugu rubripes fru-miR-29a
  51. Tetraodon nigroviridis tni-miR-29a
  52. Tor tambroides (Thai mahseer) miR-29a
  53. Xenopus laevis (African clawed frog) xla-miR-29c-3p
  54. Xenopus tropicalis Xtr-Mir-29-P2b_3p (mature (guide))
Publications