Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-29c-3p URS0000272A3D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-29c: Mmu-mir-29c is a member of the miR-29 family of miRNAs and is a putative target in various biological processes, including glucose homeostasis, myogenesis, and asthma progression [PMC3357342] [PMC3698551] [PMC5219731] [PMC3030602]. It has been observed that mmu-mir-29c interacts with MAX-like protein X (MLX) and glucagon (GCG) in the network, suggesting its involvement in glucose regulation [PMC3357342]. Mmu-mir-29c has been found to be downregulated in chronic lymphocytic leukemia patients with TP53 abnormalities and its expression has been shown to increase in glomeruli and microvascular endothelial cells in a mouse model [PMC3742134] [PMC8869454]. Overexpression of mmu-mir-29c has been associated with the activation of RhoA and suppression of Sprouty homolog 1 gene, which is implicated in diabetic nephropathy pathogenesis [PMC6032378]. Additionally, mmu-mir-29c has been linked to strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice [PMC3742134]. It is worth noting that mmu-mir-29c expression levels can vary with age, as it was found to be downregulated at intermediate and late stages of asthma progression but upregulated at the late stage along with other miRNAs such as mmu-miR-125b-5p and -574-5p [PMC3030602]. Overall, mmu-mir-29c plays a significant role in various biological processes and its dysregulation can have implications for disease pathogenesis.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-29a-3p
  2. Anolis carolinensis Aca-Mir-29-P2b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29c
  4. Bos taurus bta-miR-29c
  5. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2b_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-29c
  7. Cavia porcellus cpo-miR-29c-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-29a
  9. Chrysemys picta bellii Cpi-Mir-29-P2b_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-29a-3p
  11. Columba livia (rock pigeon) cli-miR-29a-3p
  12. Cyprinus carpio ccr-miR-29a
  13. Danio rerio dre-miR-29a
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29c-3p
  15. Echinops telfairi Ete-Mir-29-P2d_3p (mature (guide))
  16. Eptatretus burgeri Ebu-Mir-29-P2f_3p (mature (guide))
  17. Equus caballus eca-miR-29c
  18. Gadus morhua gmo-miR-29a-3p
  19. Gallus gallus Gga-Mir-29-P2b_3p (mature (guide))
  20. Gekko japonicus Gja-Mir-29-P2b_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-29c (MIR29C)
  22. Gorilla gorilla ggo-miR-29c
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29a
  24. Homo sapiens hsa-miR-29c-3p
  25. Latimeria chalumnae Lch-Mir-29-P2b_3p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P2d-v1_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-29c-3p
  28. Maylandia zebra (zebra mbuna) mze-miR-29a
  29. Microcaecilia unicolor Mun-Mir-29-P2b_3p (mature (guide))
  30. Monodelphis domestica Mdo-Mir-29-P2b_3p (mature (guide))
  31. Monopterus albus (swamp eel) Mal-Mir-29-P2b1-v1_3p (mature (guide))
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29a
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29c
  34. Ophiophagus hannah (king cobra) oha-miR-29a-3p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-29a
  36. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b_3p (mature (guide))
  37. Oryctolagus cuniculus ocu-miR-29c-3p
  38. Pan troglodytes ptr-miR-29c
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-29c
  40. Pteropus alecto pal-miR-29c-3p
  41. Pundamilia nyererei pny-miR-29a
  42. Python bivittatus Pbv-Mir-29-P2b_3p (mature (co-guide))
  43. Rattus norvegicus rno-miR-29c-3p
  44. Salmo salar (Atlantic salmon) ssa-miR-29b-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b_3p (mature (guide))
  46. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-29-P2b_3p (mature (guide))
  48. Sus scrofa ssc-miR-29c
  49. Taeniopygia guttata Tgu-Mir-29-P2b_3p (mature (guide))
  50. Takifugu rubripes fru-miR-29a
  51. Tetraodon nigroviridis tni-miR-29a
  52. Tor tambroides (Thai mahseer) miR-29a
  53. Xenopus laevis (African clawed frog) xla-miR-29c-3p
  54. Xenopus tropicalis Xtr-Mir-29-P2b_3p (mature (guide))
Publications