Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-29a URS0000272A3D_7962

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ccr-mir-29a: ccr-mir-29a is a microRNA that is potentially involved in regulating apoptosis [PMC4416013]. In the context of common carp, ccr-mir-29a and ccr-miR-143 have been identified as potential therapeutic biomarkers for remitting liver insulin resistance [PMC10113649]. It has been suggested that Momordica charantia saponins may have a role in alleviating liver insulin resistance by inhibiting ccr-mir-29a targeting pik3r1 or ccr-miR-143 targeting pik3r3 [PMC10113649]. In a study on common carp, the expression of ccr-mir-29a and ccr-miR-143 was found to be significantly downregulated in groups with liver insulin resistance compared to the control group [PMC10113649]. Additionally, 10 other differentially expressed microRNAs were identified as potential biomarkers for regulating insulin signal transduction and carbohydrate metabolism in the liver of common carp fed with a high-carbohydrate diet [PMC10113649]. These findings provide insights into the potential role of ccr-mir-29a and other microRNAs in modulating liver insulin resistance and suggest that Momordica charantia saponins may have therapeutic potential for improving insulin resistance in common carp [PMC10113649].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-29a-3p
  2. Anolis carolinensis Aca-Mir-29-P2b_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29c
  4. Bos taurus bta-miR-29c
  5. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2b_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-29c
  7. Cavia porcellus cpo-miR-29c-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-29a
  9. Chrysemys picta bellii Cpi-Mir-29-P2b_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-29a-3p
  11. Columba livia (rock pigeon) cli-miR-29a-3p
  12. Danio rerio dre-miR-29a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29c-3p
  14. Echinops telfairi Ete-Mir-29-P2d_3p (mature (guide))
  15. Eptatretus burgeri Ebu-Mir-29-P2f_3p (mature (guide))
  16. Equus caballus eca-miR-29c
  17. Gadus morhua gmo-miR-29a-3p
  18. Gallus gallus Gga-Mir-29-P2b_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-29-P2b_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-29c (MIR29C)
  21. Gorilla gorilla ggo-miR-29c
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-29a
  23. Homo sapiens hsa-miR-29c-3p
  24. Latimeria chalumnae Lch-Mir-29-P2b_3p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P2d-v1_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-29c-3p
  27. Maylandia zebra (zebra mbuna) mze-miR-29a
  28. Microcaecilia unicolor Mun-Mir-29-P2b_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-29-P2b_3p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-29-P2b1-v1_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-29c-3p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29a
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29c
  34. Ophiophagus hannah (king cobra) oha-miR-29a-3p
  35. Oreochromis niloticus (Nile tilapia) oni-miR-29a
  36. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b_3p (mature (guide))
  37. Oryctolagus cuniculus ocu-miR-29c-3p
  38. Pan troglodytes ptr-miR-29c
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-29c
  40. Pteropus alecto pal-miR-29c-3p
  41. Pundamilia nyererei pny-miR-29a
  42. Python bivittatus Pbv-Mir-29-P2b_3p (mature (co-guide))
  43. Rattus norvegicus rno-miR-29c-3p
  44. Salmo salar (Atlantic salmon) ssa-miR-29b-3p
  45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b_3p (mature (guide))
  46. Scyliorhinus torazame Sto-Mir-29-P2b_3p (mature (guide))
  47. Sphenodon punctatus Spt-Mir-29-P2b_3p (mature (guide))
  48. Sus scrofa ssc-miR-29c
  49. Taeniopygia guttata Tgu-Mir-29-P2b_3p (mature (guide))
  50. Takifugu rubripes fru-miR-29a
  51. Tetraodon nigroviridis tni-miR-29a
  52. Tor tambroides (Thai mahseer) miR-29a
  53. Xenopus laevis (African clawed frog) xla-miR-29c-3p
  54. Xenopus tropicalis Xtr-Mir-29-P2b_3p (mature (guide))
Publications