Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-126-5p URS00001D69F6_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-126: Ssc-mir-126 is a down-regulated miRNA that is significantly expressed less in HG- than in LG-IEN [PMC5707088]. It is also one of the selected genes containing differentially methylated regions (DMRs) adjacent to transcription start sites (TSSs) [PMC6014285]. Ssc-mir-126 has been validated by qRT-PCR and shown to be differentially expressed in breed groups [PMC4970254]. It is also involved in energy metabolism pathways and has been found to be differentially expressed in cancer pathways [PMC3555835]. Ssc-mir-126 and its counterpart ssc-mir-126* are transcribed together and have been found to be suggestively up-regulated in EA [PMC3555835]. The length of the ssc-mir-126 gene is 73 bp, and its mature sequence and seed region are consistent with those found in other vertebrates [PMC7080823]. The miRNA response elements (MREs) of ssc-mir-126 have been predicted using bioinformatics tools [PMC7080823]. Ssc-mir-126 is an intronic miRNA embedded within the introns of the gene encoding protein EGFL7 [PMC7080823]. References: [PMC5707088] [PMC6014285] [PMC4970254] [PMC3555835] [PMC7080823]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Danio rerio dre-miR-126a-5p
  14. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  15. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-126-5p
  17. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  18. Gallus gallus gga-miR-126-5p
  19. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  21. Homo sapiens (human) hsa-miR-126-5p
  22. Ictalurus punctatus ipu-miR-126b
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  25. Maylandia zebra (zebra mbuna) mze-miR-126
  26. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  27. Microcebus murinus (gray mouse lemur) mmr-miR-126
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  29. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  30. Mus musculus mmu-miR-126a-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  33. Oreochromis niloticus (Nile tilapia) oni-miR-126
  34. Ornithorhynchus anatinus oan-miR-126-5p
  35. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  36. Pundamilia nyererei pny-miR-126
  37. Python bivittatus pbv-miR-126-5p
  38. Rattus norvegicus rno-miR-126a-5p
  39. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  40. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications