Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-126a-5p URS00001D69F6_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-126a: Dre-mir-126a is a microRNA (miRNA) gene in zebrafish that has been studied for its potential role in gene regulation [PMC3737551]. Researchers have used TALENs (transcription activator-like effector nucleases) to target the upstream and downstream sequences of dre-mir-126a and miRNA Cluster Chr [PMC3737551]. PCR analysis showed that the deletion allele was dominant in the embryos injected with TALENs [PMC3737551]. The CRISPR/Cas gene-targeting system was also used to manipulate the dre-mir-126a locus, with gRNAs designed to target specific sequences [PMC3737551]. The efficiency of TALEN pairs correlated with the intensity of PCR products, indicating successful targeting [PMC3737551]. The CRISPR strategy has allowed for the deletion of genomic regions containing dre-mir-126a or miRNA cluster Chr.9 in zebrafish, with a success rate of 1% to 3% [PMC4613301]. Xiao et al. were the first to use CRISPR to eliminate large genomic regions in zebrafish, including dre-mir-126a or miRNA cluster Chr.9, which constitute a small percentage of the zebrafish genome [PMC5780079]. Overall, these studies demonstrate successful targeting and deletion of dre-mir-126a using TALENs and CRISPR/Cas systems in zebrafish embryos.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  14. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-126-5p
  16. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  17. Gallus gallus gga-miR-126-5p
  18. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  20. Homo sapiens (human) hsa-miR-126-5p
  21. Ictalurus punctatus ipu-miR-126b
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  24. Maylandia zebra (zebra mbuna) mze-miR-126
  25. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-126
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  28. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  29. Mus musculus mmu-miR-126a-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  32. Oreochromis niloticus (Nile tilapia) oni-miR-126
  33. Ornithorhynchus anatinus oan-miR-126-5p
  34. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  35. Pundamilia nyererei pny-miR-126
  36. Python bivittatus pbv-miR-126-5p
  37. Rattus norvegicus rno-miR-126a-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications