Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-126a-5p URS00001D69F6_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-126: Conditional ablation of Dicer in hematopoietic stem cells (HSCs) has shown that mmu-mir-126, along with other microRNAs such as mmu-miR-29a, mmu-miR-130a, mmu-miR-155, and mmu-miR-125a/b, plays a role in controlling HSC differentiation by targeting different genes [PMC6829453]. Specifically, mmu-miR-125a has been found to increase stem cell quantities by targeting BAK1 [PMC6829453]. In a study on offspring from OVA-immunized mothers, it was observed that the downregulation of mmu-mir-126 was associated with reduced IL-17-producing γδT cells [PMC8234718]. This suggests that maternal OVA immunization can influence the thymic expression of several microRNAs including mmu-mir-126 [PMC8234718]. In another study on mouse aortic endothelial cells (MAECs), miR-126 levels were modulated using miR-126 mimics and inhibitors [PMC5855744]. It is worth noting that inadvertent deletion of mmu-mir-126 has led to misattributed phenotypes in previous studies on angiogenesis defects [PMC3675212]. These findings highlight the importance of understanding the role of mmu-mir-126 in various biological processes and its potential implications in disease development and treatment.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Danio rerio dre-miR-126a-5p
  14. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  15. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-126-5p
  17. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  18. Gallus gallus gga-miR-126-5p
  19. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  21. Homo sapiens (human) hsa-miR-126-5p
  22. Ictalurus punctatus ipu-miR-126b
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  25. Maylandia zebra (zebra mbuna) mze-miR-126
  26. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  27. Microcebus murinus (gray mouse lemur) mmr-miR-126
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  29. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  32. Oreochromis niloticus (Nile tilapia) oni-miR-126
  33. Ornithorhynchus anatinus oan-miR-126-5p
  34. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  35. Pundamilia nyererei pny-miR-126
  36. Python bivittatus pbv-miR-126-5p
  37. Rattus norvegicus rno-miR-126a-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications