Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-126-5p URS00001D69F6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-126: Hsa-mir-126 is a microRNA that has been studied in the context of lung cancer. The primers used for quantitative PCR to detect hsa-mir-126 were provided as follows: forward primer 5′-ACAGTTCTCTCGTACCGTGAGTAAT-3′ and reverse primer 5′-AAAGGTTGATCTGCTCTCTCTCTC-3′ [PMC5529898]. These primers were used to amplify hsa-mir-126 in lung cancer tissue samples [PMC2764731]. The down-regulation of hsa-mir-126 was observed in the lung cancer tissue, suggesting a potential role for this microRNA in the development or progression of lung cancer [PMC2764731]. The reverse primer used for quantitative PCR was 5′-GGAACGTTCACGAATTTG-3′, and the forward primer was 5′-ATTGGAACGATACAGAGAGATT-3′ for human RNU6, which served as a control [PMC5529898]. These primers were used to detect and quantify hsa-mir-126 expression levels in lung cancer tissue samples. The down-regulation of hsa-mir-126 suggests that it may play a role as a tumor suppressor or have other regulatory functions in lung cancer development [PMC2764731]. Further research is needed to fully understand the mechanisms and implications of hsa-mir-126 dysregulation in lung cancer.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Danio rerio dre-miR-126a-5p
  14. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  15. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-126-5p
  17. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  18. Gallus gallus gga-miR-126-5p
  19. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  21. Ictalurus punctatus ipu-miR-126b
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  24. Maylandia zebra (zebra mbuna) mze-miR-126
  25. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-126
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  28. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  29. Mus musculus mmu-miR-126a-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  32. Oreochromis niloticus (Nile tilapia) oni-miR-126
  33. Ornithorhynchus anatinus oan-miR-126-5p
  34. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  35. Pundamilia nyererei pny-miR-126
  36. Python bivittatus pbv-miR-126-5p
  37. Rattus norvegicus rno-miR-126a-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications