Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-126a-5p URS00001D69F6_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-126: Rno-mir-126 is a specific type of microRNA that has been studied in various contexts. In a study on mechanical stretching, it was found that out of the miRNAs examined, only rno-mir-126 showed dysregulated expression in response to unstretched cells [PMC5856749]. Another study on mechanical stretching found that rno-mir-126 was one of the eight miRNAs dysregulated in response to four hours of stretch [PMC5856749]. The mature sequence of rno-mir-126 was identified as UCGUACCGU GAGUAAUAAUGCG [PMC5810200]. In an experiment involving diabetic rats, lentivirus expressing rno-mir-126 was administered via intravitreal injection [PMC7723505]. Additionally, a 2'-O-Methyl rno-mir-126 antagonist sequence was used in another study [PMC3986586]. Furthermore, it has been observed that exosomes from pathological cardiac myocytes (CMs) were rich in rno-miR-320 and poor in rno-mir-126 [PMC6406975]. These findings suggest that rno-mir-126 may play a role in various biological processes and pathological conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Danio rerio dre-miR-126a-5p
  14. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  15. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-126-5p
  17. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  18. Gallus gallus gga-miR-126-5p
  19. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  21. Homo sapiens (human) hsa-miR-126-5p
  22. Ictalurus punctatus ipu-miR-126b
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  25. Maylandia zebra (zebra mbuna) mze-miR-126
  26. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  27. Microcebus murinus (gray mouse lemur) mmr-miR-126
  28. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  29. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  30. Mus musculus mmu-miR-126a-5p
  31. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  33. Oreochromis niloticus (Nile tilapia) oni-miR-126
  34. Ornithorhynchus anatinus oan-miR-126-5p
  35. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  36. Pundamilia nyererei pny-miR-126
  37. Python bivittatus pbv-miR-126-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications