Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-126 URS00001D69F6_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-126: Cfa-mir-126 is a microRNA that has been found to possess higher diagnostic performance in discriminating the right or left divisional intrahepatic portosystemic shunt (IHPSS) group from the control group compared to other microRNAs such as cfa-miR-122, cfa-miR-34a, and cfa-miR-21 [PMC7356535]. It has been shown to have an area under the curve (AUC) of 1.00 in ROC analysis, indicating its strong diagnostic ability [PMC7356535]. Additionally, cfa-mir-126 has been found to be differentially expressed in both the RGC or RGC–CL groups compared to the control group, further supporting its potential as a diagnostic biomarker [PMC7356535]. ROC curve analysis has also demonstrated that cfa-mir-126 can be used as a diagnostic serum biomarker to differentiate splenocaval shunts from healthy controls [PMC7356535]. The optimal sensitivity and specificity for cfa-mir-126 have been determined at different cut-off values [PMC7356535]. Furthermore, cfa-mir-126 has been validated as one of the differentially expressed mature miRNAs in a negative miRNA–mRNA interaction network [PMC5844969]. Overall, these findings suggest that cfa-mir-126 is a promising non-invasive biomarker for various liver conditions and can reflect histopathological and molecular events occurring in different types of shunts with high sensitivity and specificity [PMC7356535][PMC5844969].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  6. Cervus elaphus (red deer) cel-miR-126*
  7. Chiloscyllium plagiosum microRNA cpl-miR-126*
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  9. Chrysemys picta cpi-miR-126-5p
  10. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  11. Cyprinus carpio ccr-miR-126-5p
  12. Danio rerio dre-miR-126a-5p
  13. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  14. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-126-5p
  16. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  17. Gallus gallus gga-miR-126-5p
  18. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  20. Homo sapiens (human) hsa-miR-126-5p
  21. Ictalurus punctatus ipu-miR-126b
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  24. Maylandia zebra (zebra mbuna) mze-miR-126
  25. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-126
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  28. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  29. Mus musculus mmu-miR-126a-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  32. Oreochromis niloticus (Nile tilapia) oni-miR-126
  33. Ornithorhynchus anatinus oan-miR-126-5p
  34. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  35. Pundamilia nyererei pny-miR-126
  36. Python bivittatus pbv-miR-126-5p
  37. Rattus norvegicus rno-miR-126a-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications