Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-126-5p URS00001D69F6_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-126: Gga-mir-126 is a microRNA that is abundantly expressed in animal gonads and has been identified in sequencing libraries [PMC3700833]. It is also involved in muscle cell differentiation and energy metabolism [PMC8531282]. In addition, gga-mir-126 has been found to be related to muscle function and expressed in the ovaries of laying chickens [PMC7326969] [PMC9563710]. Studies on mice and zebrafish have shown that miR-126 regulates vascular integrity and angiogenesis by repressing negative regulators of the VEGF pathway [PMC6716571]. Furthermore, gga-mir-126 has been used in inducible expression plasmids to study its effects on gene expression [PMC8235390]. Additionally, gga-mir-126 is one of the precursor miRNAs that showed a reversal in the ratios of the 5p- and 3p-derived sequences across RNA libraries [PMC3511444]. Overall, gga-mir-126 plays a significant role in various biological processes, including gonadal development, muscle function, angiogenesis regulation, and gene expression modulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUUAUUACUUUUGGUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-126-5p
  2. Anolis carolinensis (green anole) aca-miR-126-5p
  3. Bos taurus (cattle) bta-miR-126-5p
  4. Callorhinchus milii Cmi-Mir-126-P2-v2_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-126
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-126-P2-v2_5p (mature (guide))
  7. Cervus elaphus (red deer) cel-miR-126*
  8. Chiloscyllium plagiosum microRNA cpl-miR-126*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-P2-v2_5p (mature (guide))
  10. Chrysemys picta cpi-miR-126-5p
  11. Columba livia Cli-Mir-126-P2-v2_5p (mature (guide))
  12. Cyprinus carpio ccr-miR-126-5p
  13. Danio rerio dre-miR-126a-5p
  14. Dasypus novemcinctus Dno-Mir-126-P2-v2_5p (mature (guide))
  15. Echinops telfairi Ete-Mir-126-P2-v2_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-126-5p
  17. Gadus morhua (Atlantic cod) gmo-miR-126-5p
  18. Gekko japonicus Gja-Mir-126-P2-v2_5p (mature (guide))
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
  20. Homo sapiens (human) hsa-miR-126-5p
  21. Ictalurus punctatus ipu-miR-126b
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-126-P2-v2_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-126-P2-v2_5p (mature (guide))
  24. Maylandia zebra (zebra mbuna) mze-miR-126
  25. Microcaecilia unicolor Mun-Mir-126-P2-v2_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-126
  27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-126-5p
  28. Monopterus albus (swamp eel) Mal-Mir-126-P2b-v2_5p (mature (guide))
  29. Mus musculus mmu-miR-126a-5p
  30. Neolamprologus brichardi (lyretail cichlid) nbr-miR-126
  31. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-126
  32. Oreochromis niloticus (Nile tilapia) oni-miR-126
  33. Ornithorhynchus anatinus oan-miR-126-5p
  34. Oryzias latipes (Japanese medaka) ola-miR-126-5p
  35. Pundamilia nyererei pny-miR-126
  36. Python bivittatus pbv-miR-126-5p
  37. Rattus norvegicus rno-miR-126a-5p
  38. Salmo salar (Atlantic salmon) ssa-miR-126-5p
  39. Scyliorhinus torazame Sto-Mir-126-P2-v2_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-126-5p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-126-P2-v2_5p (mature (guide))
  42. Tetraodon nigroviridis Tni-Mir-126-P2b-v2_5p (mature (guide))
  43. Tor tambroides miR-126b-5p
  44. Xenopus laevis (African clawed frog) xla-miR-126-5p
  45. Xenopus tropicalis (tropical clawed frog) xtr-miR-126-5p
Publications