Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daubentonia madagascariensis (aye-aye) dma-miR-181c URS000018C928_31869

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  4. Gorilla gorilla ggo-miR-181c
  5. Homo sapiens hsa-miR-181c-5p
  6. Macaca mulatta mml-miR-181c-5p
  7. Mus musculus (house mouse) mmu-miR-181c-5p
  8. Pan paniscus ppa-miR-181c
  9. Pan troglodytes ptr-miR-181c
  10. Pongo pygmaeus ppy-miR-181c
  11. Rattus norvegicus rno-miR-181c-5p
  12. Sus scrofa (pig) ssc-miR-181c
  13. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-181c-5p
Relationships

Molecular Relationships